A1BG regulatory elements and regions
From Wikidoc - Reading time: 76 min
It may be still fair to say that in the apparent present era of functional genomics, the challenge is to elucidate gene function such as that of A1BG, its likely regulatory networks and signaling pathways.[1] "Since regulation of gene expression in vivo mainly occurs at the transcriptional level, identifying the location of genetic regulatory elements is a key to understanding the machinery regulating gene transcription. A major goal of current genome research is to identify the locations of all gene regulatory elements, including promoters, enhancers, silencers, insulators and boundary elements, and to analyze their relationship to the current annotation of human genes."[2][3] Although "many genome-wide strategies have been developed for identifying functional elements", "no method yet has the resolution to precisely identify all regulatory elements or can be readily applied to the entire human genome."[4]
"The experimental evidence demonstrates that genome binding specificity is achieved through the interplay of at least three factors: DNA sequence; DNA shape; and occlusion by chromatin."[5]
There is one CRISPRi-validated cis-regulatory element on 19q13.43: Gene ID: 116286197 LOC116286197. And, four Sharpr-MPRA regulatory regions: (1) Gene ID: 112553117 LOC112553117 Sharpr-MPRA regulatory region 1998, Gene ID: 112553119 LOC112553119 Sharpr-MPRA regulatory region 10473, Gene ID: 112577453 LOC112577453 Sharpr-MPRA regulatory region 7872, and Gene ID: 112577454 is Sharpr-MPRA regulatory region 9894.
Def. nucleotide "sequences, usually upstream, which are recognized by specific regulatory transcription factors, thereby causing gene response to various regulatory agents", [that] "may be found in both promoter and enhancer regions"[6] are called response elements.
Heterodimers[edit | edit source]
Some bZIP proteins, "including LIP19, OsZIP-2a, and OsZIP-2b, do not bind to DNA sequences. Instead, these bZIP proteins form heterodimers with other bZIPs to regulate transcriptional activities (Nantel and Quatrano, 1996; Shimizu et al., 2005)."[7]
DNase I hypersensitive sites[edit | edit source]
"This genomic region represents a DNase I hypersensitive site (DHS) that was predicted to be an enhancer by the ENCODE (ENCyclopedia Of DNA Elements) project based on various combinations of H3K27 acetylation and binding of p300, GATA1 and RNA polymerase II in K562 erythroleukemia cells. It was validated as a high-confidence cis-regulatory element for the ZNF582 (zinc finger protein 582) gene on chromosome 19 based on multiplex CRISPR/Cas9-mediated perturbation in K562 cells."[8]
Gene ID: 116286197 CRISPRi-validated cis-regulatory element chr19.6329 is at NC_000019.10 (56186901..56187499).[8]
Gene ID: 147948 ZNF582 is at NC_000019.10 (56382751..56393585, complement).[9] The CRISPRi-validated cis-regulatory element chr19.6329 is (56382751 - 56186901) = 195850 nts from the beginning of ZNF582.
Transcriptional regulatory regions[edit | edit source]
"This genomic sequence was predicted to be a transcriptional regulatory region based on chromatin state analysis from the ENCODE (ENCyclopedia Of DNA Elements) project. It was validated as a functional enhancer by the Sharpr-MPRA technique (Systematic high-resolution activation and repression profiling with reporter tiling using massively parallel reporter assays) in K562 erythroleukemia cells (group: K562 Activating DNase unmatched - State 1:Tss, active promoter, TSS/CpG island region), with weaker activation in HepG2 liver carcinoma cells (group: HepG2 Activating DNase matched - State 1:Tss)."[10]
"This genomic sequence was predicted to be a transcriptional regulatory region based on chromatin state analysis from the ENCODE (ENCyclopedia Of DNA Elements) project. It was validated as a functional enhancer by the Sharpr-MPRA technique (Systematic high-resolution activation and repression profiling with reporter tiling using massively parallel reporter assays) in HepG2 liver carcinoma cells (group: HepG2 Activating DNase matched - State 5:Enh, candidate strong enhancer, open chromatin). It also displayed weak repressive activity by Sharpr-MPRA in K562 erythroleukemia cells (group: K562 Repressive non-DNase unmatched - State 24:Quies, heterochromatin/dead zone)."[11]
"This genomic sequence was predicted to be a transcriptional regulatory region based on chromatin state analysis from the ENCODE (ENCyclopedia Of DNA Elements) project. It was validated as a functional enhancer by the Sharpr-MPRA technique (Systematic high-resolution activation and repression profiling with reporter tiling using massively parallel reporter assays) in both HepG2 liver carcinoma cells (group: HepG2 Activating DNase unmatched - State 1:Tss, active promoter, TSS/CpG island region) and K562 erythroleukemia cells (group: K562 Activating DNase unmatched - State 1:Tss)."[12]
"This genomic sequence was predicted to be a transcriptional regulatory region based on chromatin state analysis from the ENCODE (ENCyclopedia Of DNA Elements) project. It was validated as a functional enhancer by the Sharpr-MPRA technique (Systematic high-resolution activation and repression profiling with reporter tiling using massively parallel reporter assays) in K562 erythroleukemia cells (group: K562 Activating DNase unmatched - State 1:Tss, active promoter, TSS/CpG island region), with weaker activation in HepG2 liver carcinoma cells (group: HepG2 Activating DNase matched - State 1:Tss)."[13]
"The growth hormone-regulated transcription factors STAT5 and BCL6 coordinately regulate sex differences in mouse liver, primarily through effects in male liver, where male-biased genes are upregulated and many female-biased genes are actively repressed."[14] "CUX2, a highly female-specific liver transcription factor, contributes to an analogous regulatory network in female liver. Adenoviral overexpression of CUX2 in male liver induced 36% of female-biased genes and repressed 35% of male-biased genes. In female liver, CUX2 small interfering RNA (siRNA) preferentially induced genes repressed by adenovirus expressing CUX2 (adeno-CUX2) in male liver, and it preferentially repressed genes induced by adeno-CUX2 in male liver. CUX2 binding in female liver chromatin was enriched at sites of male-biased DNase hypersensitivity and at genomic regions showing male-enriched STAT5 binding. CUX2 binding was also enriched near genes repressed by adeno-CUX2 in male liver or induced by CUX2 siRNA in female liver but not at genes induced by adeno-CUX2, indicating that CUX2 binding is preferentially associated with gene repression. Nevertheless, direct CUX2 binding was seen at several highly female-specific genes that were positively regulated by CUX2, including A1bg [A1BG in humans], Cyp2b9, Cyp3a44, Tox [TOX in humans], and Trim24 [TRIM24 in humans]."[14]
"Gene list comparisons were performed using the compare class utility provided by the Regulatory Sequence Analysis Tools (34). Comparisons were made with previous 3-AT and rapamycin data sets (5, 14) and with several predefined gene lists such as genes induced by promoters bound in chromatin immunoprecipitation (ChIP-chip) experiments (35), genes in the MIPS functional catalogue (36), and gene ontology categories (37) as described by Godard et al. (38). The significance of overlap between gene lists was quantitatively determined by the hypergeometric distribution (39), using the number of probe sets on the S98 array as the population size, or by calculating the representation factor (40) using the web utility Microarray Analysis Tools. Upstream noncoding regulatory sequences were retrieved and analyzed using Regulatory Sequence Analysis Tools (34). The program DNA-Pattern was used to search for and catalogue occurrences of consensus GCRE (TGABTVW) and GATA (GATAAG, GATAAH, GATTA) motifs in yeast promoters. The program oligo-analysis (41) was used to search the promoter regions of co-regulated genes for overrepresented sequence motifs. Analysis of the 5-noncoding regions of the GCN4-dependent activation core identified the consensus [general control responsive element] GCRE motif (TGABTVW)."[15]
ABA-response elements[edit | edit source]
"The ABA responsive element (ABRE) is a key cis‐regulatory element in ABA signalling. However, its consensus sequence (ACGTG(G/T)C) is present in the promoters of only about 40% of ABA‐induced genes in rice aleurone cells, suggesting other ABREs may exist."[16]
"Many ABA‐inducible genes in various species contain a conserved cis‐regulatory ABA responsive element (ABRE) with the consensus sequence ACGTG(G/T)C (Hattori et al. 2002; Shen et al. 2004)."[16]
Abf1 regulatory factors[edit | edit source]
Specific "sequences considered as exact Abf1 motif occurrences": CGTNNNNNACGA(C/T), CGTNNNNNA(C/T)GAC, CGTNNNNNA(C/T)GA(C/T), CGTNNNNN(A/G)(C/T)GA(C/T).[5]
A boxes[edit | edit source]
"Most bZIP proteins show high binding affinity for the ACGT motifs, which include CACGTG (G box), GACGTC (C box), TACGTA (A box), AACGTT (T box), and a GCN4 motif, namely TGA(G/C)TCA (Landschulz et al., 1988;[17] Nijhawan et al., 2008[18])."[7]
"The human TGF-β1 promoter region contains two binding sequences for AP-1, designated AP-1 box A (TGACTCT) and box B (TGTCTCA), which mediate the up-regulation of promoter activity after [High glucose] HG stimulation."[19]
Abscisic acid-responsive elements[edit | edit source]
Abscisic acid-responsive elements (CACGTG).[20]
"The [palindromic E-box motif (CACGTG)] motif is bound by the transcription factor Pho4, [and has the] class of basic helix-loop-helix DNA binding domain and core recognition sequence (Zhou and O'Shea 2011)."[5]
The Pho4 homodimer binds to DNA sequences containing the bHLH binding site 5'-CACGTG-3'.[21]
The upstream activating sequence (UAS) for Pho4p is 5'-CAC(A/G)T(T/G)-3' in the promoters of HIS4 and PHO5 regarding phosphate limitation with respect to regulation of the purine and histidine biosynthesis pathways [66].[22]
ACA boxes[edit | edit source]
The "3' end of mature hTR (45) has an ACA trinucleotide 3 nt upstream of its 3' end. In addition, the 3' region of hTR contains a single H box consensus sequence (5'-AGAGGA-3')."[23]
ACGT-containing elements[edit | edit source]
The "binding affinities of both bZIP proteins were similar to CREA/T (ATGACGTCAT), a CRE sequence with flanking adenine and thymine (A/T) at positions -4 and +4. [The] bZIP domains of both STF1 and HY5 have similar binding properties for recognizing ACGT-containing elements (ACEs). [Although] the G-box is a known target site for the HY5 protein, the C-box sequences are the preferred binding sites for both STF1 and HY5."[24]
Activating protein 2[edit | edit source]
"AP-2 proteins can bind to G/C-rich elements, such as 5’-[G/C]CCN(3,4)GG[G/C]-3’ (41, 42)."[25]
Consensus sequences for the Activating protein 2 (AP-2) are GCCTGGCC.[26]
Activating transcription factors[edit | edit source]
"The ATF4 binding consensus sequence has been reported as (G/A/C)TT(G/A/T)C(G/A)TCA (38), which matches the ChIP-seq data."[27]
Adenylate–uridylate rich elements[edit | edit source]
"The 3′UTRs were searched for the 13-bp pattern WWWUAUUUAUWW with mismatch=−1 which was computationally derived as previously described ( 2 ). The pattern was further statistically validated against larger sets of mRNA data (10 872 mRNA with 3′UTR; GenBank 119) showing occurrence of the motif in 6.8% of human mRNA."[28]
"3′ untranslated regions play an important role in regulating mRNA fate by complexing with RNA binding proteins that help control mRNA localization, translation, and stability [1, 2, 3]. Identification of a consensus UUAUUUAU sequence in the 3′ UTRs of human and mouse mRNAs encoding tumor necrosis factor (TNF-α) and a variety of other inflammatory mediators led to the suggestion that these AU-rich elements AREs) could be important for regulating gene expression [4]."[29]
Adr1ps[edit | edit source]
The upstream activating sequence (UAS) for Adr1p is 5'-TTGGGG-3' or 5'-TTGG(A/G)G-3'.[22]
Aft1ps[edit | edit source]
The upstream activating sequence (UAS) for Aft1p is 5'-PyPuCACCCPu-3' or 5'-(C/T)(A/G)CACCC(A/G).[22]
AGC boxes[edit | edit source]
"The GCC box, also referred to as the AGC box (10), GCC element (11), or AGCCGCC sequence (13), is an ethylene-responsive element found in the promoters of a large number of [pathogenesis related] PR genes whose expression is up-regulated following pathogen attack."[30]
Androgen response elements[edit | edit source]
"The androgen response element sequence, 5'-GGTACACGGTGTTCT-3', was obtained from the National Center of Biotechnology Information (NCBI)."[31]
5'-TGGAGAACAGCCTGTTCTCCA-3' or 5'-AGAACAGCCTGTTCT-3'[32] "Using the identified AREs within our experiment a refined extended canonical ARE model is proposed and deposited in transcription factor databases [...]."[32]
Angiotensinogen core promoter elements[edit | edit source]
The consensus sequence is 5'-A/C-T-C/T-3'.[33] The core nucleotides for AGCE1 include 5'-A/C-T-C/T-G-T-G-3', "located between the TATA box and transcription initiation site (positions −25 to −1) is an authentic regulator of human AG transcription."[34]
Antioxidant-electrophile responsive elements[edit | edit source]
5'-GC(A/C/T)(A/G/T)(A/G/T)(C/G/T)T(A/C)A-3' is the consensus sequence of a functional antioxidant response element at the HIF1A locus.[35], an antioxidant response element (ARE).
ATA boxes[edit | edit source]
"The 3' flanking area contained the highly conserved hexanucleotide sequence A-A-T-A-A-A found in eukaryotic messages between the terminator codon and the polyadenylylation site (44)."[36]
AUUUA AREs[edit | edit source]
"Chen and Shyu [11] divided AREs into two classes of AUUUA-containing AREs and a third class of non-AUUUA AREs. Class I AUUUA-containing AREs had 1-3 copies of scattered AUUUA motifs coupled with a nearby U-rich region or U stretch, whereas class II AUUUA-containing AREs had at least two overlapping copies of the nonamer UUAUUUA(U/A)(U/A) in a U-rich region. Non-AUUUA AREs had a U-rich region and other unknown features, and the relationship of these sequences to AUUUA-containing AREs remains poorly understood. Subsequent studies based on analyses of a set of 4884 AUUUA-containing AREs led to a new classification based primarily on the number of overlapping AUUUA-repeats [8, 9, 10]. This classification system, with five clusters distinguished by the number of repeats, was used to identify AUUUA-containing AREs in the human genome. AREs identified using this classification were found to be abundant in 3′ UTRs of human genes."[29]
Auxin response factors[edit | edit source]
The "genome binding of two [auxin response factors] ARFs (ARF2 and ARF5/Monopteros [MP]) differ largely because these two factors have different preferred ARF binding site (ARFbs) arrangements (orientation and spacing)."[37] "ARFbs were originally defined as TGTCTC (Ulmasov et al., 1995, Guilfoyle et al., 1998), [...]. More recently, protein binding microarray (PBM) experiments suggested that TGTCGG are preferred ARFbs, [...] (Boer et al., 2014, Franco-Zorrilla et al., 2014, Liao et al., 2015)."[37]
A more general consensus sequence may be 1(C/G/T)-2N-3(G/T)-4G-5(C/T)-6(C/T)-7N-8N-9N-10N, where ARF2[b] is 1(C/G/T)-2(A/C/T)-3(G/T)-4G-5(C/T)-6(C/T)-7(G/T)-8(C/G)-9(A/C/T)-10(A/G/T) and ARF5/MP[b] is 1(C/G/T)-2N-3(G/T)-4G-5T-6C-7(G/T)-8N-9-10N.[37] ARF1[b] has 4G.[37]
B boxes[edit | edit source]
While there appear to be at least two B boxes, TGGGCA is one B-box,[38] where the "mP2 EB fragment used for binding was the 118 nucleotide fragment extending from the Dde I site at position -140 to the Dde I site at position -23 [...]. This fragment contains the GC, E, B, CAAT, and TATA boxes."[38]
The other is associated with the human transforming growth factor b1 binding sequences.[39]
And, has the consensus sequence 5'-TGTCTCA-3'.
B recognition elements[edit | edit source]
The factor II B recognition element is BREu.
"The transcription factor II B recognition elements BREu "CGACGCA" and BREd "ATGGTTG" were upstream (− 279 to − 273 of the transcript) and downstream (− 165 to − 159 of the transcript) of the TATA box, respectively."[40]
The general consensus sequence using degenerate nucleotides is 5’-SSRCGCC-3’, where S = G or C and R = A or G.[41]
The consensus sequence is 5’-G/C G/C G/A C G C C-3’.[42]
CadC binding domains[edit | edit source]
"Altogether, the specific contacts observed suggest a consensus binding motif of 5′-T-T-A-x-x-x-x-T-3′."[43] "Dimerization of [cadaverine C-terminal] CadC enables the binding of two DBDs to the two Cad1 consensus target sites."[43] "The DNA consensus sequence 5′-T-T-A-x-x-x-x-T-3′ is present once in the quasi-palindromic Cad1 17-mer DNA, consistent with the formation of a 1:1 complex. However, a second consensus facilitates the formation of the 2:1 complex of CadC with Cad1 41-mer DNA as evidenced by the CadC model with the minimal Cad1 26-mer DNA that spans the two AT-rich regions, i.e. consensus sites."[43]
Calcineurin-responsive transcription factors[edit | edit source]
The upstream activating sequence for the calcineurin-responsive transcription factor (Crz1p) is 5'-TG(A/C)GCCNC-3'.[22]
Carbohydrate response elements[edit | edit source]
"The putative ChREBP binding sites [are] ChoRE1 (CACGTGACCGGATCTTG, -324 to -308) and ChoRE2 (TCCGCCCCCATCACGTG, -298 to - 282) [...], where the 5-nt spacer [Carb and Carb1 is] between the two E-boxes in ChoRE motifs [CarbE1, CarbE2 and CarbE3]."[44]
CAREs[edit | edit source]
"GARE and a novel CARE (CAACTC regulatory elements) elements are present in the promoter of rice RAmy1A (Ueguchi-Tanaka et al. 2000; Sutoh and Yamauchi 2003)."[45]
CArG boxes[edit | edit source]
"RIN [Ripening Inhibitor] binds to DNA sequences known as the CA/T-rich-G (CArG) box, which is the general target of MADS box proteins (Ito et al., 2008)."[46]
"MADS-box proteins bind to a consensus sequence, the CArG box, that has the core motif CC(A/T)6GG (15)."[47]
"Of the [Flowering Locus C] FLC binding sites, 69% contained at least one CArG-box motif with the core consensus sequence CCAAAAAT(G/A)G and an AAA extension at the 3′ end [...]."[47]
Three "other MADS-box flowering-time regulators, SOC1, SVP, and AGAMOUS-LIKE 24 (AGL24), bind to two different CArG-box motifs at 502 bp (CTAAATATGG) and 287 bp (CAATAATTGG) upstream of the translation start in the SEP3 gene (24), consistent with different specificities for the different MADS-box proteins."[47] These together with the core motif CC(A/T)6GG (15) suggest a more general CArG-box motif of (C(C/A/T)(A/T)6(A/G)G).
Cat8p gene transcriptions[edit | edit source]
The upstream activating sequence (UAS) for Cat8p is 5'-CGGNBNVMHGGA-3', where N = A, C, G, T, B = C, G, T, V = A, C, G, M = A, C, and H = A, C, T; i.e. 5'-CGG(A/C/G/T)(C/G/T)(A/C/G/T)(A/C/G)(A/C)(A/C/T)GGA-3'.[22]
CAT boxes[edit | edit source]
"The M-CAT consensus sequence [is] CATTCCT".[48]
"A [chloramphenicol acetyltransferase] CAT-box-like element, GCCATT [34], adjacent to the GC-box, is conserved in the three promoters."[48]
C boxes[edit | edit source]
"Most bZIP proteins show high binding affinity for the ACGT motifs, which include [...] GACGTC (C-box) [...]."[7]
Analysis "of the recombinant (soybean [Glycine max] TGACG-motif binding factor 1) STF1 protein revealed the C-box (nGACGTCn) to be a high-affinity binding site (Cheong et al., 1998). [...] To test whether STF1 and HY5 have similar DNA-binding properties, the binding properties of each were compared with eight different DNA sequences that represent G-, C-, and C/G-box motifs [TGACGTGT]. C-box sequences carrying the mammalian cAMP responsive element (CRE; TGACGTCA) motif and the Hex sequence (TGACGTGGC), a hybrid C/G-box (Cheong et al., 1998), were high-affinity binding sites for both proteins [...]."[24]
The human ribosomal protein L11 gene (HRPL11) has [...] two potential snRNA-coding sequences in intron 4: the C box beginning at +4131 (GGTGATG), [...] a D box beginning at +4237 (TCCTG), [...].[49]
"Members of the box C/D snoRNA family, which are the subject of the present report, possess characteristic sequence elements known as box C (UGAUGA) and box D (GUCUGA)."[50]
Substituting T for U yields C box = 5'-AGTAGT-3' in the translation direction on the template strand.
CCAAT-box-binding transcription factors[edit | edit source]
The upstream activating sequence (UAS) for the Hap4p is 5'-CCAAT-3'.[22]
Cell-cycle boxes[edit | edit source]
"The 5' non-coding part contains the sequence elements characteristic for eukaryotic promoters such as TATA and CAAT boxes as well as an inverted motif typical for cell-cycle regulated genes named "cell-cycle box" (CCB). The consensus sequence of CCB is CACGAAAA (Nasmyth, 1985), however, more relaxed variants such as CACGAAA, ACGAAA and C-CGAAA were described in budding yeast CLN1 and CLN2 (Ogas et al, 1991)."[51]
CGCG boxes[edit | edit source]
"The minimum DNA-binding elements are 6-bp CGCG box, (A/C/G)CGCG(C/G/T)."[41]
Circadian control elements[edit | edit source]
"The circadian control element (circadian; Anderson et al., 1994) was found in 10 FvTCP genes."[52]
Circadian control elements (CAANNNNATC).[20]
Class C DNA binding sites[edit | edit source]
The "Class C" DNA binding site at position -379/-374 in a reverse (-) orientation with a consensus sequence of CACGNG of the bHLH Hey-1 protein had a strong DNA binding activity.[53]
Cold-responsive elements[edit | edit source]
A "putative cold-responsive element (CRE) [...] is specified by a conserved 5-bp core sequence (CCGAC) typical for C-repeat (CRT)/dehydration-responsive elements (DRE) that are recognized by cold-specific transcription factors (TFs) [16]."[54]
Copper response elements[edit | edit source]
"Chlamydomonas reinhardtii activates the transcription of the Cyc6 and the Cpx1 genes (encoding cytochrome c6 and coprogen oxidase) in response to copper deficiency."[55]
"A consensus copper-response element [CuRE] TTTGC(T/G)C(A/G) (12) is a binding site for Mac1p."[55]
"An additional EMSA result demonstrated that [Aspergillus fumigatus (Af)] AfMac1 directly binds to a copper response element in the promoter regions of the ctrA2 and ctrC genes with a defined consensus DNA motif (5′-TGTGCTCA-3′) (Park et al., 2017[56]), which is strikingly similar to the Mac1-binding motif in S. cerevisiae (Jamison McDaniels et al., 1999; Keller et al., 2000), suggesting that the mechanism of Mac1-mediated copper homeostasis may be conserved across fungal species."[24]
Coupling elements[edit | edit source]
"In barley, the combination of an ABRE and one of two known coupling elements CE1 (TGCCACCGG) and CE3 (GCGTGTC) constitutes an ABA responsive complex (ABRC) in the regulation of the ABA‐inducible genes HVA1 and HVA22 (Shen and Ho 1995; Shen et al. 1996)."[16]
"In Arabidopsis, the CE3 element is practically absent; thus, Arabidopsis relies on paired ABREs to form ABRCs (Gomez‐Porras et al. 2007) or on the coupling of a DRE (TACCGACAT) with ABRE (Narusaka et al. 2003; Nakashima et al. 2006)."[16]
"To identify potential cis-regulatory elements in the promoter sequences of ZmGRXCC genes, the 1500 bp sequences of each [maize CC-type glutaredoxin (GRX)] ZmGRXCC gene upstream of the ATG start codon were selected from the maize genome as the promoter, and the promoter sequence was screened using PlantCARE [32]. The elements searched included [...] CE3 (coupling element 3, -CACGCG-) for ABA responsiveness [...]."[57]
CRE boxes[edit | edit source]
"Within the cAMP-responsive element of the somatostatin gene, we observed an 8-base palindrome, 5'-TGACGTCA-3', which is highly conserved in many other genes whose expression is regulated by cAMP."[58]
The upstream activating sequence (UAS) for the Aca1p, the basic "leucine zipper (bZIP) transcription factor [55] involved in carbon source utilization" is 5'-TGACGTCA-3'[22] the same as a CRE.
The upstream activating sequence (UAS) for the Sko1p, involved "in osmotic and oxidative stress responses" is 5'-TGACGTCA-3'[22] the same as a CRE.
Root specific elements are the same as CREs.
Cytokinin response regulators[edit | edit source]
"Cytokinin fulfills its diverse roles in planta through a series of transcriptional responses."[59]
"Cytokinin employs a two-component multi-step phosphorelay for its perception and signaling transduction12–14. In Arabidopsis, there are three cytokinin receptors (ARABIDOPSIS HISTIDINE KINASEs; AHK2, 3, 4) and eleven type-B response regulators (ARABIDOSPIS RESPONSE REGULATORs; B-ARRs)8,15."[59]
"The cytokinin transcriptional response centrally affects the family of ARRs. Type-B ARRs (B-ARRs) are transcription factors (TFs) with a GARP-like DNA binding domain at their C-termini and a receiver domain at their N-termini. Type-A ARRs (A-ARRs) are similar to the N-termini receiver domain of B-ARRs but do not possess a DNA binding domain."[59]
Cytoplasmic polyadenylation elements[edit | edit source]
"The most well-understood mechanism for controlling cytoplasmic polyadenylation is regulation of mRNAs containing the cytoplasmic polyadenylation element (CPE; consensus UUUUUAU) by CPE-binding protein (CPEB)1."[60]
"Cytoplasmic polyadenylation is determined by the cytoplasmic polyadenylation element (CPE; consensus sequence UUUUUAU) that resides in mRNA 3′ untranslated regions (UTRs)."[61]
DAF-16 binding elements[edit | edit source]
"Most paralogous FOX proteins bind to the canonical DNA response element 5′-RYAAAYA-3′ (R = A or G, Y = C or T)11–13."[62]
D boxes[edit | edit source]
There is one D box 5'-AGTCTG-3'.[50]
The human ribosomal protein L11 gene (HRPL11) has two potential snRNA-coding sequences in intron 4: a D box beginning at +4237 (TCCTG).[49]
A D-box is (TGAGTGG).[63]
DNA damage response elements[edit | edit source]
"A consensus sequence, 5'-TAGCCGCCGRRRR-3' (where R = an unspecified purine nucleoside [A/G],was generated from these data."[64]
"The extent of homology for the entire 13 bp ranged from 56 to 100%. However, for the symmetrical core sequence CCGCC 75 to 100% homology was observed with only conservative substitutions occurring in the nonhomologous positions."[64]
Downstream B recognition elements[edit | edit source]
The downstream B recognition element [(A/G)T(A/G/T)(G/T)(G/T)(G/T)(G/T)] designated as the BREd,[47] or dBRE, is an additional core promoter element that occurs downstream of the TATA box and is recognized by general transcription factor II B.[47]
Downstream core elements[edit | edit source]
A core promoter that contains all three subelements of the downstream core element [DCE] may be much less common than one containing only one or two.[65] "SI resides approximately from +6 to +11, SII from +16 to +21, and SIII from +30 to +34."[65]
The consensus sequence for the DCE is CTTC...CTGT...AGC.[65] These three consensus elements are referred to as subelements: "SI is CTTC, SII is CTGT, and SIII is AGC."[65]
Downstream promoter elements[edit | edit source]
The early DPE consensus sequence was RGWCGTG.[66][67]
The DPE consensus sequence is the more general sequence RGWYVT, or (A/G)G(A/T)(C/T)(A/C/G)T.[68]
The DPE in "the ATP‐binding cassette subfamily G member 2 gene in the marine pufferfish Takifugu rubripes" is 5'-AGTCTC-3'.[40]
E2 boxes[edit | edit source]
"The most dramatic impact on immunoglobulin gene enhancer activity was observed upon mutation of sites that contain an E2-box motif (G/ACAGNTGN)."[69]
EIN3 binding sites[edit | edit source]
"We scanned the ORE1 promoter and found a putative EIN3 binding site (EBS), ATGAACCT, located 1056~1064 bp upstream from the start codon (ATG) of the gene [...]."[70]
"EIN3/EIL1 transcription factors were reported to bind to a consensus DNA sequence of A[CT]G[AT]A[CT]CT [34,35]."[70]
Endoplasmic reticulum stress response elements[edit | edit source]
"The released aminoterminal of ATF6 (ATF6-N) then migrates to the nucleus and binds to the ER stress response element (ERSE) containing the consensus sequence CCAAT-N9-CCACG to activate genes encoding ER chaperones, ERAD components, and XBP1 (Chen et al., 2010; Yamamoto et al., 2004; Yoshida et al., 2001)."[71]
Endosperm expression[edit | edit source]
Endosperm expression (TGTGTCA).[20]
Enhancer boxes[edit | edit source]
The consensus sequence for the E-box element is CANNTG, with a palindromic canonical sequence of CACGTG.[72]
Ethylene responsive elements[edit | edit source]
Ethylene responsive elements (ATTTCAAA).[20]
Forkhead boxes[edit | edit source]
"Most paralogous FOX proteins bind to the canonical DNA response element 5′-RYAAAYA-3′ (R = A or G, Y = C or T)11–13."[62]
GAAC elements[edit | edit source]
"[A] short sequence [in TSE1 contains] a GAACT motif that [binds] a tendon-specific nuclear protein."[73]
GA responsive elements[edit | edit source]
"Although this GARC [GA responsive complex] may not always be tripartite, most often it includes three sequence motifs, the TAACAAA box or GA responsive element (GARE), the pyrimidine box CCTTTT, and the TATCCAC box (Skriver et al., 1991;Gubler and Jacobsen, 1992; Rogers et al., 1994)."[74]
Several GA-responsive cis-acting elements (GARE) and GARE-like elements (TAACAA/GA, or TAACGTA) have been identified in the promoters of hydrolase genes expressed in the aleurone (Ueguchi-Tanaka et al. 2000; Sutoh and Yamauchi 2003; Washio 2003), expansin genes expressed in internodes (Lee et al. 2001), and many GAMYB-regulated genes expressed in anthers (Tsuji et al. 2006)."[45]
GATA boxes[edit | edit source]
GTGA-box has the consensus sequence GATA.[75]
GC boxes[edit | edit source]
"A GC box sequence, one of the most common regulatory DNA elements of eukaryotic genes, is recognized by the Spl transcription factor; its consensus sequence is represented as 5'-G/T G/A GGCG G/T G/A G/A C/T-3' [or 5′-KRGGCGKRRY-3′] (Briggs et al., 1986)."[76]
GCC elements[edit | edit source]
"The GCC box, also referred to as the AGC box (10), GCC element (11), or AGCCGCC sequence (13), is an ethylene-responsive element found in the promoters of a large number of [pathogenesis related] PR genes whose expression is up-regulated following pathogen attack."[30]
Gcn4ps[edit | edit source]
"The program DNA-Pattern was used to search for and catalogue occurrences of consensus GCRE (TGABTVW) [TGA(C/G/T)T(A/C/G)(A/T)] and GATA (GATAAG, GATAAH, GATTA) motifs in yeast promoters."[15]
"The predicted Gln3p and Gcn4p binding sites in the UGA3 promoter are [...] the consensus Gln3p (GATA) and Gcn4p (GCRE) [TGAGTCA] binding sites present in the minimal UGA3 promoter at -206 and -112, respectively, [...]."[15]
GGC triplets[edit | edit source]
"The transcription factors Uga3, Dal81 and Leu3 belong to the class III family (Zn(II)2Cys6 proteins), and they recognize highly related sequences rich in GGC triplets [15]."[77]
"MEME analysis identified phylogenetically conserved CCGN4CGG motifs in promoters of several [branched-chain amino acid] BCAA biosynthetic genes"[78]
Gibberellin responsive elements[edit | edit source]
Gibberellin responsive elements (CCTTTTG, AAACAGA).[20]
Γ-interferon activated sequences[edit | edit source]
"Computer analysis of the nt −653 to nt −483 region identified two sites that resemble the [γ-interferon activated sequence] GAS consensus sequence, TTNCNNNAA (19). Similar GAS-like sites have been shown to mediate the effects of various cytokines, including [growth hormone] GH, on the transcription of other genes (19, 20). The first site, TTCCTAGAA (ALS-GAS1), is located between nt −633 and nt −625; the second site, TTAGACAAA (ALS-GAS2), is located between nt −553 and nt −545."[79]
Glucocorticoid response elements[edit | edit source]
"DNA-binding by the GR-DBD has been well-characterized; it is highly sequence-specific, directly recognizing invariant guanine nucleotides of two AGAACA [TGTTCT] half sites called the glucocorticoid response element (GRE), and binds as a dimer in head-to-head orientation with mid-nanomolar affinity (4,12–18). [...] The consensus DNA glucocorticoid response element (GRE) is comprised of two half-sites (AGAACA) separated by a three base-pair spacer (13,15,60,61)."[80]
Gcr1ps[edit | edit source]
The upstream activating sequence (UAS) for Gcr1p is 5'-CTTCC-3' for the transcriptional activator involved in the regulation of glycolysis [77].[22]
GT boxes[edit | edit source]
"Comparison of the sequence of the newly cloned mouse MMP-9 promoter region with our previous human isolate revealed that [...] four units of GGGG(T/A)GGGG sequence (GT box) were conserved between the two species."[81]
Hac1s[edit | edit source]
"The similar UPRE-1 is also found in the promoter region of the P. pastoris KAR2 (CAGCGTG), INO1 (CAACTTG) and HAC1 (CAACTTG) genes [15]. The presence of an HAC1 UPRE implies that Hac1p can up-regulate its own transcription. Unconventional splicing of HAC1 mRNA after ER stress signaling generates the active form of basic leucine zipper (bZIP) transcription factor Hac1p, which binds to the UPRE [16]."[82]
H boxes[edit | edit source]
"The box H/ACA snoRNAs [...] have the consensus H box sequence (5'-ANANNA-3') but have no other primary sequence identity."[23]
The "3' end of mature [human telomerase] hTR (45) has an ACA trinucleotide 3 nt upstream of its 3' end. In addition, the 3' region of hTR contains a single H box consensus sequence (5'-AGAGGA-3')."[23]
"Comparison with the murine telomerase RNA (mTR) (7) suggests that the snoRNA-like features of hTR are evolutionarily conserved. The mTR 3' end [...] includes consensus H (5'-ACAGGA-3') and ACA box sequences."[23]
An H box has a consensus sequence of 3'-ACACCA-5'.[83]
"In humans, telomerase is composed of a reverse transcriptase (hTERT), which uses the RNA component (hTERC) to dock onto the 3′ single-stranded telomere end. hTERT may then processively synthesise telomeric repeats from the template provided by hTERC, before dissociating7–9. All telomerase RNAs possess a 3′ end element necessary for its stability10. In hTERC, this is two stem-loop structures separated by an H-box (ANANNA) and ACA motif (H/ACA). The binding of telomerase factors dyskerin, NOP10, and NHP2 at the H/ACA motif form the so-called ‘pre-ribonucleoprotein complex’, before GAR1 binds in transition to the mature RNP11,12. hTERC then binds to chaperone TCAB1, which assists its trafficking to the Cajal bodies where the functional telomerase complex localises13. Recruitment to the telomeres in S-phase is mediated by the protective complex shelterin14,15. Correct assembly of the telomerase complex, with appropriate co-factors for maturation, stability, and subcellular localisation, is necessary for its function and thus telomere maintenance."[84]
"The KAP-2 protein [...] binds to the H-box (CCTACC) element in the bean CHS15 chalcone synthase promoter".[85]
"Two distinct sequence elements, the H-box (consensus CCTACC(N)7CT) and the G-box (CACGTG), are required for stimulation of the chs15 promoter by 4-CA."[86]
Heat shock elements[edit | edit source]
"In response to elevated temperatures, cells from many organisms rapidly transcribe a number of mRNAs. In Saccharomyces cerevisiae, this protective response involves two regulatory systems: the heat shock transcription factor (Hsf1) and the Msn2 and Msn4 (Msn2/4) transcription factors."[87]
"Yeast Hsf1 is an essential protein that binds to inverted repeats of nGAAn called heat shock elements (HSEs) within the promoters of many HSPs and activates their transcription."[87]
Hex sequences[edit | edit source]
The Hex sequence has the consensus (TGACGTGGC).[24]
HMG boxes[edit | edit source]
"Most HMG box proteins contain two or more HMG boxes and appear to bind DNA in a relatively sequence-aspecific manner (5, 13, 15, 16 and references therein). [...] they all appear to bind to the minor groove of the A/T A/T C A A A G-motif (10, 14, 18-20)."[88]
HNFs[edit | edit source]
Gene ID: 6927 is HNF1A HNF1 homeobox A aka TCF1 on 12q24.31: "The protein encoded by this gene is a transcription factor required for the expression of several liver-specific genes. The encoded protein functions as a homodimer and binds to the inverted palindrome 5'-GTTAATNATTAAC-3'. Defects in this gene are a cause of maturity onset diabetes of the young type 3 (MODY3) and also can result in the appearance of hepatic adenomas. Alternative splicing results in multiple transcript variants encoding different isoforms."[89]
"Canonical Wnt signaling results in the accumulation and binding of β-catenin to DNA-binding partner TCF1."[90] TCF-1 binding site is CCTTTGA.[90]
"HNF3 can bind to the site in the absence of HNF6 (Lahuna et al. 1997)."[91]
Homeoboxes[edit | edit source]
"Transcription factors Pax-4 and Pax-6 are known to be key regulators of pancreatic cell differentiation and development. [...] The gene-targeting experiments revealed that Pax-4 and Pax-6 cannot substitute for each other in tissue with overlapping expression of both genes. [The] DNA-binding specificities of Pax-4 and Pax-6 are similar. The Pax-4 homeodomain [HD] was shown to preferentially dimerize on DNA sequences consisting of an inverted TAAT motif, separated by 4-nucleotide spacing."[92]
The "crucial difference between the binding sites of Antennapedia class and TTF-1 HDs is in the motifs 5'-TAAT-3', recognized by Antennapedia [a Hox gene, a subset of homeobox genes, first discovered in Drosophila which controls the formation of legs during development], and 5'-CAAG-3', preferentially bound by TTF-1. [The] binding of wild type and mutants TTF-1 HD to oligonucleotides containing either 5'-TAAT-3' or 5'-CAAG-3' indicate that only in the presence of the latter motif the Gln50 in TTF-1 HD is utilized for DNA recognition."[93]
Hsf1ps[edit | edit source]
The upstream activating sequence (UAS) for the Hsf1p is NGAAN.[22]
"Yeast Hsf1 is an essential protein that binds to inverted repeats of nGAAn called heat shock elements (HSEs) within the promoters of many HSPs and activates their transcription."[87]
Hypoxia response elements[edit | edit source]
"Putative EPO promoter HREs. Location of two conserved potential promoter HREs (pHRE1 and pHRE2; [CACGC]) close to the GATA ([GATA]) and [Wilms tumor gene] WT1 ([GCCTCTCCCCCACCCCCACCCGCGCACGCAC]) sites in the EPO proximal 5' region. [For human and other vertebrates] is a UCSC Genome Browser output (version hg19), including 161 transcription factor ChIP-sequencing (ChIP-seq) tracks derived from the ENCODE database (version 3), clusters of DNaseI hypersensitivity sites (HSS) from 125 cell types, and the transcriptional start site (TSS), with a closer view of the region in 50 vertebrates extracted using the 100-MULTIZ whole-genome multiple sequence alignment algorithm."[94]
HY boxes[edit | edit source]
"Deletion analysis by a series of 5′-deletion constructs identified the responsive region to RUNX-2 as being between −81 bp and −76 bp, containing a putative RUNX-2 binding sequence (TGAGGG), which is similar to that identified in the promoter region of human interleukin-3 (TGTGGG) (33)."[95]
"Deletion, mutagenesis, and tandem repeat analyses identified the core responsive element as the region between −89 and −60 bp (termed the hypertrophy box [HY box]), which showed specific binding to RUNX‐2."[95]
Initiator elements (YYANWYY)[edit | edit source]
The Inr has the consensus sequence YYANWYY.[96]
Initiator elements (BBCABW)[edit | edit source]
"Kadonaga and colleagues (Vo ngoc et al. 2017) devised and implemented a novel multistep approach that combines experimental and computational methods to reinvestigate the human Inr consensus sequence. First, they generated two 5′-GRO-seq (5′ end-selected global run-on followed by sequencing) libraries with human MCF-7 cells to identify the 5′ ends of nascent capped transcripts. Second, they developed a peak-calling algorithm named FocusTSS to find transcripts in the 5′-GRO-seq data sets that were initiated at a focused position on the genome, hence identifying clear TSSs to enable analysis of Inr sequences. FocusTSS identified 7678 TSSs that were in both data sets. Third, to identify sequence motifs enriched among the focused TSSs, they used the HOMER motif discovery tool (Heinz et al. 2010), which yielded an Inr-like consensus sequence of BBCABW from −3 to +3 (where, B = C/G/T, W = A/T, and +1 is [A]). Forty percent of the focused TSSs contained a perfect match to the BBCABW consensus Inr."[97]
Initiator-like element, TCT[edit | edit source]
Consensus sequence for an Inr-like/TCT is TTCTCT.[40]
Inositol/choline-responsive elements[edit | edit source]
"This ICRE (consensus sequence TYTTCACATGY) contains the core sequence CANNTG, which is also known as an E box and which serves as a recognition site for DNA-binding proteins of the basic helix-loop-helix (bHLH) family (3). Members of the bHLH family comprise determinants of cellular differentiation and proliferation in mammalian and invertebrate systems such as the myogenic transcription factors MyoD, MRF4, myogenin and Myf-5(4) as well as factors not restricted to specialized tisues (E12, E47, daughterless, c-Myc and Mad; 5-7). Proteins of the bHLH group may form either homodimers or heterodimers or both, dependent on the individual structure of the respective interaction surface provided by the HLH domain(8)."[98]
"The UAS INO is thus also referred to as the inositol/choline-responsive element (ICRE). The UAS INO contains the consensus sequence CATGTGAAAT, which includes the canonical basic helix-loop-helix (bHLH) binding site CANNTG (Lopes et al. 1991)."[99]
"All IN01 fusion constructs that retained regulation in response to the phospholipid precursors inositol and choline, contained at least one copy of a nine bp repeated element (consensus, 5'-ATGTGAAAT-3')."[100]
Interferon regulatory factors[edit | edit source]
Consensus sequence for IRF-3 is 5'-GCTTTCC-3'.[44]
There "are totally 11 members (from IRF-1 to IRF-11) identified from vertebrates [10]. All the IRF members share a well-conserved N-terminal helix-turn-helix IRF superfamily domain (also called DNA-binding domain, DBD) with five conserved tryptophan (Trp) residues, which could recognize DNA sequences containing 5’-GAAA-3’ tetranucleotide, such as the IFN-stimulated response element (ISREs, GAAANNGAAA) [11, 12]. Moreover, it was reported that the IRS consensus (-78/-66, AANNGAAA), which existed in the promoter region of IFN-β, could be bound by the IRF family members [13]. As for the C-terminus, most of the IRFs share an IRF-3 superfamily domain, which was also named as IRF associated domain 1 (IAD1). IRF-1 and IRF-2 do not possess conserved IAD1 domain, but they contain non-conserved activation domain (the last 100 amino acids of IRF-1 were rich in tyrosine) or repression domain (the final 25 amino acids of IRF-2 were rich in histidine, arginine and lysine) in their C-terminus, respectively."[101]
Jasmonic acid-responsive elements[edit | edit source]
Jasmonic acid-responsive elements (TGACG, CGTCA).[20]
Krüppel-like factors[edit | edit source]
"Krüppel-like factor 1 (KLF1/EKLF) is a transcription factor that globally activates genes involved in erythroid cell development. [...] KLF1 belongs to the KLF family of transcription factors that binds the G-rich strand of so-called CACCC-box motifs located in regulatory regions of numerous erythroid genes."[102]
"Using the in vitro CASTing method, we identified a new set of sequences bound by [congenital dyserythropoietic anemia] CDA-KLF1, and based on them we defined the consensus binding site as 5′-NGG-GG(T/G)-(T/G)(T/G)(T/G)-3′. It differs from the consensus binding sites for [wild-type] WT-KLF1, 5′-NGG-G(C/T)G-(T/G)GG-3′, and for [neonatal anemia] Nan-KLF1, 5′-NGG-G(C/A)N-(T/G)GG-3′, as well."[102]
Leu3[edit | edit source]
With HAS1 ending at zero and TDA1 beginning at above 1000 bp, Leu3 is from 536 - 545 nts yielding consensus sequences (C/G)C(G/T)NNNN(A/C)G(C/G), 569 - 574 Mig1 (C/T)(C/T)CC(A/G)G and Sdd4 (A/C/T)CCCAC, 585 - 592 Rgt1 (A/T)(A/T)N(A/T)(C/T)CCG, 610 - 617 Rgt1 (A/T)(A/T)N(A/T)(C/T)CCG, 630 - 637 Rgt CGG(A/G)(A/T)N(A/T)(A/T).[103]
M35 boxes[edit | edit source]
The trp promoter has a consensus -35 sequence (TTGACA).[104]
M-boxes[edit | edit source]
"The conserved region contains a consensus M-box element (TCACATGA) for binding of MITF. This MITF binding site is aligned and conserved between at least 11 different species [...]. The clear conservation of these elements suggests that gpnmb has similar regulation in all mammals."[105]
Mcm1 regulatory factors[edit | edit source]
Consensus sequences: NN(A/C/T)(A/C/T)NC(C/T)(A/C/T)(A/C/T)(A/T)(A/C/T)(A/C/T)N(A/G)(C/G/T)(A/C/T)NNN.[5]
The primary consensus sequence is apparently TT(A/T)CCNN(A/T)TNGG(A/T)AA.[5]
A "subset of bound and unbound motif occurrences [...] contained all of the most highly conserved nucleotides of the 16-bp pseudosymmetric motif (TTnCCnnnTnnGGnAA) ([...] Shore and Sharrocks 1995; Hughes and de Boer 2013)."[5]
Met31ps[edit | edit source]
Consensus sequence for Met31 binding motif is AAACTGTGG in sulfur amino acid metabolism.[22]
"Both Met31p and Met32p bind to the 5′‐AAACTGTG‐3′ core sequence which is, besides the 5′‐TCACGTG‐3′ element, the second regulatory element known to be involved in the regulation of several MET genes (Thomas et al., 1989)."[106]
Metal responsive elements[edit | edit source]
"To execute the transcriptional regulation, [Metal-responsive transcription factor-1] MTF-1 binds to the specific site, called [metal responsive element] MRE (core sequence = TGCRCNC), in the promoter region of target gene (Günther et al. 2012a)."[107]
Middle sporulation elements[edit | edit source]
"These genomic sequences were analysed for the presence of [...] middle sporulation elements (MSE) motif (5'-ACACAAA-3') using the NCBI BLAST tool."[108]
Of the midsporulation element (MSE), "a minimal element, CRCAAA(A/T), is sufficient for sporulation specificity."[109]
Mig1ps[edit | edit source]
The upstream activating sequence (UAS) for the Mig1p transcription factor is 5'-SYGGGG-3' or 5'-(C/G)(C/T)GGGG-3'.[22]
Msn2,4p[edit | edit source]
The upstream activating sequence (UAS) for the Msn2,4p transcription factor is 5'-CCCCT-3'.[22]
"[msn2p] is a transcription factor that binds to stress-response elements (STREs) resulting in the induction of more than 200 genes.10,11 STRE has a core pentameric cis-acting sequence CCCCT and is located in promoter regions of the induced genes."[110]
Musashi binding elements[edit | edit source]
"The 24-nt Xenopus Mos [polyadenylation response element] PRE (Charlesworth et al, 2002) contained a match to the SELEX-derived murine Musashi RNA binding consensus sequence (G/AU1−3AGU) (Imai et al, 2001), and included a 3′ U residue essential for PRE function (Charlesworth et al, 2002) [...]."[111]
"Regarding the 3′ UTR cis-regulatory sequences such as AREs (PAS) [110], BRD-Box [111] and MBE [112] mediates negative post-transcriptional regulation by affecting mRNA transcript stability and translational efficiency [110], [140]. In our case, the 3′ cis-regulatory signals, BRD-Box and MBE, located upstream and downstream PAS [...] may regulate tissue-specific alternative polyadenylation which has been detected in approximately 54% of human genes [142]."[112]
"The [Musashi-binding element] MBE consensus sequence is (G/A)U1–3AGU."[113]
MYB recognition elements[edit | edit source]
"These elements fit the type II MYB consensus sequence A(A/C)C(A/T)A(A/C)C, suggesting that they are MYB recognition elements (MREs)."[114]
MYB binding site involved in drought induction (TAACTG).[20]
Myocyte enhancer factor 2 (MEF2)[edit | edit source]
Myocyte enhancer factor-2 (MEF2) proteins are a family of transcription factors which through control of gene expression are important regulators of cellular differentiation and consequently play a critical role in embryonic development.[115] In adult organisms, Mef2 proteins mediate the stress response in some tissues.[115]
"The current study delineates the conformational paradigm, clustered recognition, and comparative DNA binding preferences for MEF2A and MEF2B-specific MADS-box/MEF2 domains at the YTA(A/T)4TAR consensus motif."[116] Y = (C/T) and R = (A/G). The consensus sequence is (C/T)TA(A/T)(A/T)(A/T)(A/T)TA(A/G).[116]
Nanos/Pumilio response elements[edit | edit source]
"The 3′ UTR of eEF1A contains a putative [Nanos/Pumilio response element (PRE)] PRE sequence (TGTAAAT), suggesting that it is a Nanos/Pumilio target."[117]
Recurrent "kmers occurring in 3′ UTRs were identified in the single-read FLASH data. The polyadenylation signal [ ATA box ] AATAAA had the highest Z-score, and three similar sequences were also found in the top 10 kmers. However, on correlation with down-regulation, the TGTAAAT motif was found by MEME (Bailey and Elkan 1994) at 294 sites (E-value 2.7 × 10−562), which is different from the motif identified by RIP-seq [...]."[118]
N-boxes[edit | edit source]
"Human pColQ1a carries consensus sequences for transcriptional factors E-protein (E-box, CANNTG), NFAT (GGAAA), c-Ets transcription factor [c-Ets, (C/A)GGA(A/T)], Elk-1, N-box (CCGGAA), and MEF2 (CTAAAAATAA), which play essential roles in muscle-specific and NMJ-specific transcriptional activities (Lee et al., 2004)."[119]
"The [basic helix–loop–helix] bHLH proteins from group E were usually bound to the CACGCG [Coupling element] or CACGAG (N-box) motif."[120]
"Group E comprises two families in which the proteins have a conserved Pro or Gly residue within the basic region that mediates preferential binding to the N-box sequences CACGGC or CACGAC."[121]
"The HEY1 gene binds E-box (CANGTG) and N-box (CACNAG) sites (31,32)."[122]
The "putative consensus binding sites of Notch target genes in human IDE promoter" included the N-box from "the first translation start site (ATG)" -3711/-3715 position in a forward (+) orientation with a consensus sequence of CACNAG of the bHLH protein HES-1 with a strong DNA binding activity.[53] For the closer binding position -310/-305 in a reverse (-) orientation of the bHLH protein Hey-1 CACNAG had a weak DNA binding activity.[53] The "Class C" DNA binding site at position -379/-374 in a reverse (-) orientation with a consensus sequence of CACGNG of the bHLH Hey-1 protein had a strong DNA binding activity.[53]
Non-DiTyrosine 80 transcription factors[edit | edit source]
"The Saccharomyces cerevisiae Ndt80 protein is the founding member of a class of p53-like transcription factors that is known as the NDT80/PhoG-like DNA-binding family."[123]
Ndt80 [Non-DiTyrosine 80] is a meiosis-specific transcription factor required for successful completion of meiosis and spore formation.[124] The DNA-binding domain of Ndt80 has been isolated, and the structure reveals that this protein is a member of the Ig-fold family of transcription factors.[125] Ndt80 also competes with the repressor SUM1 for binding to promoters containing MSEs.[126]
Direct "binding of Ndt80 to the [mid sporulation element CRCAAAA/T (Ozsarac et al. 1997)] MSE is necessary for activating transcription of the middle sporulation genes."[127]
"These genomic sequences were analysed for the presence of [...] middle sporulation elements (MSE) motif (5'-ACACAAA-3') using the NCBI BLAST tool."[108]
Nuclear factor of activated T cell transcriptions[edit | edit source]
Mutation "of the core NFATp binding sequence (GGAAAA) in the IL2 promoter NFAT site entirely eliminates the function of the site, as does mutation of an adjacent non-canonical AP-1 site that is not essential for NFATp binding but that is required for formation of the NFATp-Fos-Jun complex(6, 15).3"[128]
Nuclear factor 1[edit | edit source]
Nuclear factor 1 (NF-1) is a family of closely related transcription factors that constitutively bind as dimers to specific sequences of DNA with high affinity.[129] Family members contain an unusual DNA binding domain that binds to the recognition sequence 5'-TTGGCXXXXXGCCAA-3'.[130]
Consensus sequences for the nuclear factor 1 are TGGCA, TGGCG and TGGAA.[131]
An apparent consensus sequence for the NF1 is TGG(A/C)(A/G).
Nutrient-sensing response element 1[edit | edit source]
There is only one nucleotide difference between the SESN2 CARE and the ATF4-inducible asparagine synthase gene ASNS consensus sequence (GTTTCATCA).[132]
Oaf1 transcription factors[edit | edit source]
The upstream activating sequence (UAS) for the Oaf1p transcription factor is 5'-CGGN3TNAN9-12CCG-3'.[22]
ORE1 binding sites[edit | edit source]
"As a transcription factor, ORE1 was reported to bind to consensus DNA sequences of [ACG][CA]GT[AG]N{5,6}[CT]AC[AG] [29] or T[TAG][GA]CGT[GA][TCA][TAG] [37]."[70]
Consensus sequences are 5'-(A/C/G)(A/C)GT(A/G)N5,6(C/T)AC(A/G)-3' or 5'-T(A/G/T)(A/G)CGT(A/G)(A/C/T)(A/G/T)-3'.[70]
p53 response elements[edit | edit source]
"A p53 consensus DNA RE is composed of a tandem of two decameric palindromic sequences (half-sites) 5′-RRRCWWGYYY-3′, where R = purine, Y = pyrimidine and W is either A or T. There is a variability in composition of p53 REs, thus two half-sites can be separated by a spacer DNA, typically 0–13 bp in length and many p53 DNA REs have varying numbers of half-sites (19,20,22,33–37)."[133]
p53 response elements found in the promoter of TUG1: 5'-CAGGCCC-3' and 5'-GGGCGTG-3'.[44]
P boxes[edit | edit source]
"As VRI [target gene: vrille (VRI)] accumulates in the nucleus during the mid to late day, it binds VRI/PDP1ϵ binding sites (V/P-boxes) [consensus of V box: A(/G)TTA(/T)T(/C), of P-box: GTAAT(/C)], to repress Clk and cry transcription (Hardin, 2004)."[134]
Peroxisome proliferator-activated receptor alpha[edit | edit source]
Consensus sequence is 5'-CGACCCC-3'.[44]
Phosphate starvation-response transcription factors[edit | edit source]
"The [palindromic E-box motif (CACGTG)] motif is bound by the transcription factor Pho4, [and has the] class of basic helix-loop-helix DNA binding domain and core recognition sequence (Zhou and O'Shea 2011)."[5]
The Pho4 homodimer binds to DNA sequences containing the bHLH binding site 5'-CACGTG-3'.[21]
The upstream activating sequence (UAS) for Pho4p is 5'-CAC(A/G)T(T/G)-3' in the promoters of HIS4 and PHO5 regarding phosphate limitation with respect to regulation of the purine and histidine biosynthesis pathways [66].[22]
Pollen1 elements[edit | edit source]
"Electrophoretic mobility shift assays identified a pollen-specific cis-acting element POLLEN1 (AGAAA) mapped at AtACBP4 (−157/−153) which interacted with nuclear proteins from flower and this was substantiated by DNase I footprinting."[75]
"Given that AtACBP4pro::GUS (−156/−67) could drive promoter activity for pollen expression, [electrophoretic mobility shift assays] EMSAs were carried out to investigate the role of the putative POLLEN1 cis-element, AGAAA (−150/−146), and its adjacent co-dependent regulatory element TCCACCATA (–141/–133)."[75]
"POLLEN1 and the TCCACCATA element are co-dependent regulatory elements responsible for pollen-specific activation of tomato LAT52 (Bate and Twell 1998)."[75]
Polycomb response elements[edit | edit source]
"Two predicted [Pleiohomeotic] Pho-Phol binding sites, CGCCATTT, that closely resemble the extended Pho-Phol consensus sequence, CGCCAT(T/A)TT (Kahn et al. 2014), are located within PRE1.1 [...]."[135]
Pribnow boxes[edit | edit source]
"Two domains upstream of the start site of transcription have been identified for which a consensus sequence has been formulated(1-5). These domains are the -35 sequence (5'-T-T-G-A-C-A) and the Pribnow box (5'-T-A-T-A-A-T) in the -10 region. Both domains are in close contact with the RNA polymerase during initiation of RNAsynthesis (2,6)."[104]
Prolamin boxes[edit | edit source]
"The main cis-element present in their promoters is an endosperm-specific box [19,20], which consists of two motifs: a GLM (GCN4-like motif) (5′ G(A)TGA(G) GTCAT 3′) that shares homology with yeast GCN4 [21], and a 7 bp P-box (Prolamin box) (5′TGTAAAG3′) [22–24]."[136]
Pyrimidine boxes[edit | edit source]
"Prediction of cis-regulatory elements using bioinformatics tools: Upstream 1500bp sequence of transcriptional start site of each gene were searched using PLANTCARE database to identify the cis-regulatory elements of NtSUT1-5 genes. Moreover, manual scanning was also done to identify the presence of sugar responsive elements such as sucrose box (NNAATCA) (Chen et al., 2002; Fillion et al., 1999) and pyrimidine box (CCTTTT, TTTTTTCC) (Washio, 2003)."[137]
"Promoter analysis of five SUTs revealed the presence of sugar responsive element, A-box (TACGTA), which is involved in regulation of sucrose transporters upon addition of sucrose (Kühn, 2011; Osuna et al., 2007). Sugar responsive elements such as sucrose box (NNAATCA) (Chen et al., 2002; Fillion et al., 1999) important for sugar responsive gene expression, pyrimidine box (CCTTTT) (Washio, 2003) partially involved in sugar repression were also observed."[137]
Q elements[edit | edit source]
"The basal regulatory elements identified include a putative TATA-box (−30/−24) for RNA polymerase binding and a CAAT box (−64/−61; [...]). Several putative floral expression-related cis-elements identified included a putative 6-nucleotide Q element (−770/−665), three GTGA boxes (−372/−369, −209/−206 and −164/−161) and four putative highly-conserved POLLEN1 boxes (−737/−733, −711/−707, −150/−146 and −36/−32; [...])."[75]
The consensus sequence for a Q element is 5'-AGGTCA-3'.[75]
Quinone reductase response elements[edit | edit source]
The quinone reductase (QRDRE) gene contains TCCCCTTGCGTG which has the DRE core of TNGCGTG.[138]
Rap1 regulatory factors[edit | edit source]
Consensus sequences: C(A/C/G)(A/C/G)(A/G)(C/G/T)C(A/C/T)(A/G/T)(C/G/T)(A/G/T)(A/C/G)(A/C)(A/C/T)(A/C/T).[5]
"Rap1 is another GRF that organizes chromatin, binds promoters of genes that encode ribosomal and glycolytic proteins, and binds telomeres (Shore 1994; Ganapathi et al. 2011; Hughes and de Boer 2013). [...] DNA shape analysis revealed that Rap1 motifs possess an intrinsically wide minor groove spanning the central degenerate region of the motif that was wider at binding-competent sites [...]. A clear trend was observed between increased width of the minor groove in the central degenerate region of the motif and increased Rap1 binding in vitro."[5]
Copying an apparent consensus sequence for Rap1 (CCCACCAACAAAA) and putting it in "⌘F" finds none located between ZSCAN22 or none between ZNF497 and A1BG as can be found by the computer programs.
Reb1 general regulatory factors[edit | edit source]
Purified "Reb1 bound [...] exact TTACCCK occurrences [...] with >60% of 780 occurrences at promoters. [And can have] the extended motif VTTACCCGNH (IUPAC nomenclature) (Rhee and Pugh 2011)."[5]
Copying the apparent consensus sequence for Reb1 (TTACCC(G/T)) and putting it in "⌘F" finds one located between ZSCAN22 or none between ZNF497 and A1BG as can be found by the computer programs. However, an extended Reb1 (ATTACCCGAA) finds none located between ZSCAN22 or between ZNF497 and A1BG.
Retinoblastoma control elements[edit | edit source]
"Robbins et al. (18) have reported that expression of pRB in mouse fibroblasts suppresses transcription of c-fos and have identified an element, termed the retinoblastoma control element (RCE), in the c-fos promoter necessary for this suppression. More recently, sequences homologous to the RCE have been identified in the TGF-β1, -β2, and -β3 promoters by Kim et al. (19)."[139]
"Comparison of the sequence of the newly cloned mouse MMP-9 promoter region with our previous human isolate revealed that [...] four units of GGGG(T/A)GGGG sequence (GT box) were conserved between the two species."[140]
"Expression of some matrix metalloproteinases (MMPs) are regulated by cytokines and tumor promoters, namely tumor necrosis factor-𝛂 (TNF-𝛂), epidermal growth factor, interleukin-1, and 12-O-tetradecanoylphorbol-13-acetate (TPA) (15-20)."[140]
Expression "of v-Src induces the synthesis of MMP-9, which is mediated by alterations in activity of binding factors for the AP-1 site and the sequence motif GGGGTGGGG (GT box). This GT box is homologous to the so-called retinoblastoma (Rb) control element (RCE) (29,30), and Rb can produce an anti-oncogene or tumor suppressor gene product (31-38) which is involved in regulating transcription of certain genes."[140]
Binding site for NF𝛋B in humans (GGAATTCCCC) with a core of (GAATTC), Sp-1 (CCGCCCC), 12-O-tetradecanoylphorbol-13-acetate (TPA) responsive element (TRE) (TGAGTCA), and GC box (GGGCGG).[140]
"Angiotensin II (Ang II) up-regulates plasminogen-activator inhibitor type-1 (PAI-1) expression in mesangial cells to enhance extracellular matrix formation. The proximal promoter region (bp -87 to -45) of the human PAI-1 gene contains several potent binding sites for transcription factors [two phorbol-ester-response-element (TRE)-like sequences; D-box (-82 to -76) and P-box (-61 to 54), and one Sp1 binding site-like sequence, Sp1-box 1 (-72 to -67)]."[63]
"The methylation-interference experiment demonstrated that human recombinant Sp1 bound to the so-called GT box (TGGGTGGGGCT, -78 to -69), which contains the Sp1-box 1."[63]
D-box (TGAGTGG), Sp1-box 1 (GGGGCT), P-box (TGAGTTCA), Sp1-box 2 (CTGCCC), and TATA box (TATAAA).[63]
Retinoic acid response elements[edit | edit source]
Retinoic acid response elements (RAREs).
"Retinoic acid is considered as the earliest factor for regulating anteroposterior axis of neural tube and positioning of structures in developing brain through retinoic acid response elements (RARE) consensus sequence (5′–AGGTCA–3′) in promoter regions of retinoic acid-dependent genes."[141]
"Several studies have suggested that the target gene of the RA signal generally contains two direct-repeat half sites of the consensus sequence AGGTCA that are spaced by one to five base pairs (14,16,32,38)."[142]
"Xavier-Neto’s review demonstrated that the magic AGGTCA has high affinity but poor specificity (16). Some other [nuclear receptors] NRs also utilized the RARE with the same spacer models that are used by RXRs/RARs, for example, orphan receptors, vitamin D receptors (VDR) and peroxisome proliferator-activated receptors (PPAR) (32,39). Identifying a bona fide RARE is more difficult than a simple inspection. In order to attribute the RARE in Cx43 to a candidate sequence, some observations have been conducted in our study using molecular, biological and biophysical methods and functional approaches. In a ligand-dependent luciferase assay, RARE was located between the −1,426 to −341 base pair position. The constitutively active mutant Cx43 RARE represses the luciferase activity in the absence of the ligand and has no response to the 9cRA. Our findings indicate that RARE in the Cx43 promoter is a functional element."[142]
Additional response elements that include the 5'-AGGTCA-3' are Q elements, ROR-response elements and Thyroid hormone response elements.
A likely general consensus sequence may be 5'-AG(A/G)TCA-3'.[142]
Copying the apparent consensus sequence for the RARE (AGGTCA) and putting it in "⌘F" finds two located between ZSCAN22 and A1BG and three between ZNF497 and A1BG as can be found by the computer programs.
Rgt1 transcription factors[edit | edit source]
"Using MAP-C [Mutation Analysis in Pools by Chromosome conformation capture], we show that inducible interchromosomal pairing between HAS1pr-TDA1pr alleles in saturated cultures of Saccharomyces yeast is mediated by three transcription factors, Leu3, Sdd4 (Ypr022c), and Rgt1. The coincident, combined binding of all three factors is strongest at the HAS1pr-TDA1pr locus and is also specific to saturated conditions. We applied MAP-C to further explore the biochemical mechanism of these contacts, and find they require the structured regulatory domain of Rgt1, but no known interaction partners of Rgt1."[103]
With HAS1 ending at zero and TDA1 beginning at above 1000 bp, 585 - 592 Rgt1 (A/T)(A/T)N(A/T)(C/T)CCG, 610 - 617 Rgt1 (A/T)(A/T)N(A/T)(C/T)CCG, 630 - 637 Rgt CGG(A/G)(A/T)N(A/T)(A/T), the third Rgt1 is the inverse of the first two.[103]
Rgt1 is also known as glucose transporter gene repressor.
Root specific elements[edit | edit source]
Root specific elements (TGACGTCA).[20]
ROR-response elements[edit | edit source]
RAR-related orphan receptor "ROR-γ binds DNA with specific sequence motifs AA/TNTAGGTCA (the classic RORE motif) or CT/AG/AGGNCA (the variant RORE motif)13, 31."[143]
Copying the apparent consensus sequence for the RORE (ATATAGGTCA) and putting it in "⌘F" finds one located between ZSCAN22 and A1BG and none between ZNF497 and A1BG as can be found by the computer programs.
Copying the apparent consensus sequence for the variant RORE (CTGGGACA) and putting it in "⌘F" finds two located between ZSCAN22 and A1BG and one between ZNF497 and A1BG as can be found by the computer programs.
R response elements[edit | edit source]
The consensus sequence for the RRE is 5'-CATCTG-3'.[144]
Serum response elements[edit | edit source]
The SRE wild type (SREwt) contains the nucleotide sequence ACAGGATGTCCATATTAGGACATCTGC, of which CCATATTAGG is the CArG box, TTAGGACAT is the C/EBP box, and CATCTG is the E box.[145]
5'-CCATATTAGG-3' is a CArG box that does not occur in either promoter of A1BG.
5'-CATCTG-3' is an E box that does not occur in either promoter of A1BG.
5'-TTAGGACAT-3' is a C/EBP box that does not occur in either promoter of A1BG using "⌘F".
5'-ACAGGATGT-3' is contained in the above nucleotide sequence which has one occurring between ZNF497 and A1BG using "⌘F" and none between ZSCAN22 and A1BG.
Servenius sequences[edit | edit source]
The "positive effect of W element may result from cooperative interactions between Z and other downstream elements such as the Servenius sequence, GGACCCT, located from -131 to -125 bp(28,38)."[146]
Specificity proteins[edit | edit source]
Sp1-box 1 (GGGGCT) and Sp1-box 2 (CTGCCC).[63]
"Sp3 has been shown to repress transcriptional activity of Sp1 [9]."[63]
Sp-1 (CCGCCCC).[140]
Sp1 (GCGGC).[131]
SP1 (GGGGCGGGCC).[44]
An apparent consensus sequences for Sp1 (GGGGCT), (CTGCCC) or (CCGCCCC) is 5'-(C/G)(C/G/T)G(C/G)C(C/T)-3'. Or, each must be considered separately.
Copying the apparent consensus sequences for Sp1 (GGGGCT), (CTGCCC) or (CCGCCCC) and putting each sequence in "⌘F" finds none located between ZSCAN22 and A1BG and four, two or none between ZNF497 and A1BG as can be found by the computer programs.
STATs[edit | edit source]
A "homologous IFN-𝛄 activation site (GAS) element, having the consensus sequence TTC/ANNNG/TAA, is found in the promoters of several [interferon-stimulated genes] ISG.(37–40)"[147] Consensus sequences: STAT1 - TTCC(C/G)GGAA, STAT3 - TTCC(C/G)GGAA, STAT4 - TTCCGGAA, STAT5 - TTCNNNGAA and STAT6 - TTCNNNNGAA.[147]
"The GAS element is palindromic and the sequence TTCN(2-4)GAA defines the optimal binding site for all STATs, with the exception of STAT2 which appears to be defective in GAS-DNA binding [...]."[148]
Ste12p[edit | edit source]
The upstream activating sequence (UAS) for [Sterile 12 protein] Ste12p is 5'-TGAAAC-3'.[22]
Sucrose boxes[edit | edit source]
Manual "scanning was also done to identify the presence of sugar responsive elements such as sucrose box (NNAATCA) (Chen et al., 2002; Fillion et al., 1999) and pyrimidine box (CCTTTT, TTTTTTCC) (Washio, 2003)."[137]
Synaptic Activity-Responsive Elements[edit | edit source]
"A unique synaptic activity-responsive element (SARE) sequence, composed of the consensus binding sites for SRF, MEF2 and CREB, is necessary for control of transcriptional upregulation of the Arc gene in response to synaptic activity."[149]
"Within the cAMP-responsive element of the somatostatin gene, we observed an 8-base palindrome, 5'-TGACGTCA-3', which is highly conserved in many other genes whose expression is regulated by cAMP."[58]
The consensus sequence for the myocyte enhancer factor 2 (MEF2) is (C/T)TA(A/T)(A/T)(A/T)(A/T)TA(A/G).[116]
The SRE wild type (SREwt) contains the nucleotide sequence ACAGGATGTCCATATTAGGACATCTGC, of which CCATATTAGG is the CArG box, TTAGGACAT is the C/EBP box, and CATCTG is the E box.[145]
TACTAAC boxes[edit | edit source]
"A consensus sequence TACTAA(C/T) was derived for the branch site of Dictyostelium introns."[150]
TAGteams[edit | edit source]
The "heptamer consensus sequence CAGGTAG (i.e., the TAGteam) is overrepresented in regulatory regions of the earliest expressed zygotic genes [2]."[151]
Copying the consensus TAGteam: 5'-CAGGTAG-3' and putting the sequence in "⌘F" finds one location between ZNF497 and A1BG or no locations between ZSCAN22 and A1BG as can be found by the computer programs.
Tapetum boxes[edit | edit source]
The consensus sequence for the TAPETUM box is TCGTGT.[75]
TATA boxes[edit | edit source]
"About 24% of human genes have a TATA-like element and their promoters are generally AT-rich; however, only ~10% of these TATA-containing promoters have the canonical TATA box (TATAWAWR)."[41]
TAT boxes[edit | edit source]
Only an inverse and its complement occurs between ZSCAN22 and A1BG: 5'-TACCTAT-3' at 2996 nts from ZSCAN22.
T boxes[edit | edit source]
"The different inducing activities of Xbra, VegT and Eomesodermin suggest that the proteins might recognise different DNA target sequences. [...] All three proteins prove to recognise the same core sequence of TCACACCT with some differences in flanking nucleotides."[152]
"Most bZIP proteins show high binding affinity for the ACGT motifs, which include [...] AACGTT (T box) [...]."[7]
"Despite sequence variations within the Tbox DBD between family members, all members of the family appear to bind to the same DNA consensus sequence, TCACACCT. In several in vitro binding-site selection studies, members of the Tbox family were found to bind preferentially sequences containing two or more of these core motifs arranged in various orientations; however, the significance of such double sites in vivo is uncertain, as most Tbox target gene sites have been found to contain only a single consensus motif (18)."[153]
TEA consensus sequences[edit | edit source]
"The TEA/ATTS transcription factor family consists of mammalian, avian, nematode, insect and fungal members that share a conserved TEA domain. The TEA domain (Bürglin, 1991) represents a DNA‐binding region that is composed of 66–76 conserved amino acids (aa) in the N‐terminal section of the proteins."[154]
"The TEA consensus sequence (TCS) in a fungal TEA/ATTS transcription factor target promoter has been defined as 5′‐CATTCY‐3′ (Andrianopoulos and Timberlake, 1994)."[154]
Tec1ps[edit | edit source]
The upstream activating sequence (UAS) for Tec1p is 5'-GAATGT-3'.[22]
Telomeric repeat DNA-binding factors[edit | edit source]
In the nucleotides between ZSCAN22 and A1BG there is are ten 5'-TTAGGG-3' beginning about 300 nucleotides from ZSCAN22 or ending at about 3900 nts. There are two among the nucleotides between ZNF497 and A1BG as A1BG is approached from ZNF497.
Homo sapiens genes containing these are found using Homo sapiens "TRF (TTAGGG repeat binding factor)".[155]
Thyroid hormone response elements[edit | edit source]
"The arrangement of TREs within the promoter might regulate THR action by determining THR isoform binding, THR dimerization, and coregulators binding. In the classic view of how TH and its receptor stimulate gene expression, the gene promoter contains TREs consisting of a 6-bp consensus sequence (AGGTCA) organized as a direct repeat separated by 4 bp (DR4), a palindrome without spacing (PAL), or an inverted palindrome (LAP) separated by 4 to 6 bp (10–13)."[156]
Transcription factor 3[edit | edit source]
Transcription factor 3 (E2A immunoglobulin enhancer-binding factors E12/E47) (TCF3), is a protein that in humans is encoded by the TCF3 gene.[157][158] TCF3 has been shown to directly enhance Hes1 (a well-known target of Notch signaling) expression.[159]
This gene encodes a member of the E protein (class I) family of helix-loop-helix transcription factors. The 9aaTAD transactivation domains of E proteins and MLL are very similar and both bind to the KIX domain of general transcriptional mediator CBP.[160][161] E proteins activate transcription by binding to regulatory E-box sequences on target genes as heterodimers or homodimers, and are inhibited by heterodimerization with inhibitor of DNA-binding (class IV) helix-loop-helix proteins. E proteins play a critical role in lymphopoiesis, and the encoded protein is required for B and T lymphocyte development.[162]
Consensus sequence found in the promoter of TUG1 is 5'-GTCTGGT-3'.[44]
Translational control sequences[edit | edit source]
"Maternal mRNAs are translationally regulated during early development. Zar1 and its closely related homolog, Zar2, are both crucial in early development. Xenopus laevis Zygote arrest 2 (Zar2) binds to the Translational Control Sequence (TCS) in maternal mRNAs and regulates translation."[163]
"Putative TCSs have been identified in Wee1, PCM-1 and Mos 3′ UTRs. The TCSs are slightly different: AUUAUCU (Wee1 TCS1), AUUGUCU (Wee1 TCS2) and UUUGUCU (Mos and PCM-1 TCS) [20]".[163]
Unfolded protein response elements[edit | edit source]
X-box binding protein 1s "XBP1s binds to the [unfolded protein response] UPR element (UPRE) containing the consensus sequence TGACGTGG/A and regulates the transcription of target genes in a cell type- and condition-specific manner (Yamamoto et al., 2004)."[71]
The consensus sequence for UPRE is 5'-TGACGTG(G/A)-3'.[71]
Upstream stimulating factors[edit | edit source]
"The helix-loop-helix transcription factor USF (upstream stimulating factor) binds to a regulatory sequence of the human insulin gene enhancer."[164]
"The regulation of insulin gene expression is dependent on sequences located upstream of the transcription start site (Clark and Docherty, 1992). Two important cis-acting elements, the insulin enhancer binding site 1 (IEBI) or NIR box and the IEB2 or FAR box, have been identified in the rat insulin I gene (Karlsson et al., 1987, 1989). Located at positions -104 (IEBI/NIR) and -233 (IEB2/FAR), these elements share an identical 8 bp sequence, GCCATCTG, which contains a consensus sequence, CANNTG, characteristic of E-box elements (Kingston, 1989). E boxes are present in enhancers from a variety of genes, including immunoglobulin and muscle-specific genes, where they interact with transcription factors containing a helix-loop-helix (HLH) dimerization domain (Murre et al., 1989)."[164]
"The IEB1 box is highly conserved among insulin genes, and is thus likely to play an important role in controlling transcription. The IEB2 site is not well conserved; in the rat insulin 2 gene the equivalent sequence is GCCACCCAGGAG, and in the human insulin gene the homologous sequence, which has been previously designated the GC2 box (Boam et al., 1990a), is GCCACCGG."[164]
"Confirmation that USF bound at the IEB2 site was obtained using an oligonucleotide containing the USF binding site from the adenovirus MLP."[164]
A likely general USF box consensus sequence may be 5'-GCC(A/T)NN(C/G/T)(A/G)-3'.
V boxes[edit | edit source]
"As VRI accumulates in the nucleus during the mid to late day, it binds VRI/PDP1ϵ binding sites (V/P-boxes) [consensus V box:A(/G)TTA(/T)T(/C), P box:GTAAT(/C)], to repress Clk and cry transcription (Hardin, 2004)."[134]
In the negative direction (from ZSCAN22 to A1BG) there are up to 81 V boxes, 28 to 4538 nts from ZSCAN22 with the apparent TSS at 4460 nts.
In the positive direction (from ZNF497 to A1BG) there are up to 21 V boxes, 23 to 4310 nts from ZNF497 with the known TSS at 4300 nts.
Vitamin D response elements[edit | edit source]
"Using the Jasper and Consite algorithms, the A/GGG/TTCAnnnA/GGG/TTCA and GA/GGTTCATnnnGTTCA sequences were considered as human and mouse VDRE consensus sequences, respectively, as previously shown.17, 18 Previous studies have suggested that regulatory VDREs could locate distally, i.e. > 1 Mb, to the transcription starting site.19 We analysed the entire genomic sequence of the human and murine HOTAIR and ANRIL genes as well as 5 kb upstream the transcription starting sites to include proximal promoter regions. Our analysis revealed two and three potential VDREs in the human HOTAIR and ANRIL genes, respectively, all of them were located within the intron 1 [...]."[165]
W boxes[edit | edit source]
The "presence of WRKY TF binding sites (C/TTGACC/T, W boxes) in numerous co-regulated Arabidopsis defense gene promoters provided circumstantial evidence that zinc-finger-type WRKY factors play a broad and pivotal role in regulating defenses [10]."[166]
The W box is a DNA cis-regulatory element sequence, (T)TGAC(C/T), which is recognized by the family of WRKY transcription factors.[167][168]
X core promoter elements[edit | edit source]
"[T]he X gene core promoter element 1 ... is located between nucleotides -8 and +2 relative to the transcriptional start site (+1) and has a consensus sequence of G/A/T-G/C-G-T/C-G-G-G/A-A-G/C+1-A/C."[169]
Xenobiotic responsive elements[edit | edit source]
The classical recognition motif of the AhR/ARNT complex, referred to as either the AhR-, dioxin- or xenobiotic- responsive element (AHRE, DRE or XRE), contains the core sequence 5'-GCGTG-3'[170] within the consensus sequence 5'-T/GNGCGTGA/CG/CA-3'[171][138] in the promoter region of AhR responsive genes. The AhR/ARNT heterodimer directly binds the AHRE/DRE/XRE core sequence in an asymmetric manner such that ARNT binds to 5'-GTG-3' and AhR binding 5'-TC/TGC-3'.[172][173][174] Recent research suggests that a second type of element termed AHRE-II, 5'-CATG(N6)C[T/A]TG-3', is capable of indirectly acting with the AhR/ARNT complex.[175][176]
Yap recognition sequences[edit | edit source]
"Saccharomyces cerevisiae contains eight members of a novel and fungus-specific family of bZIP proteins that is defined by four atypical residues on the DNA-binding surface. Two of these proteins, Yap1 and Yap2, are transcriptional activators involved in pleiotropic drug resistance. Although initially described as AP-1 factors, at least four Yap proteins bind most efficiently to TTACTAA, a sequence that differs at position ±2 from the optimal AP-1 site (TGACTCA); further, a Yap-like derivative of the AP-1 factor Gcn4 (A239Q S242F) binds efficiently to the Yap recognition sequence."[177]
The upstream activating sequence (UAS) for Yap1p/2p is TTACTAA, which is found in genes GSH1, TRX2, YCF1, GLR1, induced by oxidative stress such as H2O2, for regulation of genes expressed in response to environmental changes.[22]
YY1[edit | edit source]
YY1 consensus sequence is 5'-CCATTTA-3' and 5'-CCATCTT-3'.[44]
Z boxes[edit | edit source]
"The HY5 protein interacts with both the G- (CACGTG) and Z- (ATACGTGT) boxes of the light-regulated promoter of RbcS1A (ribulose bisphosphate carboxylase small subunit) and the CHS (chalcone synthase) genes (Ang et al., 1998; Chattopadhyay et al., 1998; Yadav et al., 2002)."[24]
Z-boxes 1-3 contain 5'-AGGTG-3'.[178]
Response element positive results[edit | edit source]
Response element negative results[edit | edit source]
Hypotheses[edit | edit source]
- Downstream core promoters may work as transcription factors even as their complements or inverses.
- In addition to the DNA binding sequences listed above, the transcription factors that can open up and attach through the local epigenome need to be known and specified.
- Each DNA binding domain serving as a transcription factor for the promoter of any immunoglobulin supergene family member, also serves or is present in the promoters for A1BG.
- The function of A1BG is the same as other immunoglobulin genes possessing the immunoglobulin domain cl11960 and/or any of three immunoglobulin-like domains: pfam13895, cd05751 and smart00410 in the order and nucleotide sequence: cd05751 Location: 401 → 493, smart00410 Location: 218 → 280, pfam13895 Location: 210 → 301 and cl11960 Location: 28 → 110.
See also[edit | edit source]
- A1BG gene transcription core promoters
- A1BG gene transcriptions
- A1BG regulatory elements and regions
- A1BG response element gene transcriptions
- A1BG response element negative results
- A1BG response element positive results
- Alpha-1-B glycoprotein
- Complex locus A1BG and ZNF497
- Immunoglobulin domain cl11960
- Immunoglobulin like domain cd05751
- Immunoglobulin like domain pfam13895
- Immunoglobulin like domain smart00410
- Immunoglobulin supergene family
- Nuclear factor gene transcriptions
- SCAN domain
References[edit | edit source]
- ↑ Francis S Collins, Eric D Green, Alan E Guttmacher, Mark S Guyer (24 April 2003). "A vision for the future of genomics research". Nature. 422 (6934): 835–47. doi:10.1038/nature01626. PMID 12695777. Retrieved 9 August 2020.
- ↑ The ENCODE Project Consortium (22 October 2004). "The ENCODE (ENCyclopedia of DNA Elements) Project". Science. 306 (5696): 636–640. doi:10.1126/science.1105136. PMID 15499007. Retrieved 9 August 2020.
- ↑ The ENCODE Project Consortium (14 June 2007). "Identification and analysis of functional elements in 1% of the human genome by the ENCODE pilot project". Nature. 447 (7146): 799–816. doi:10.1038/nature05874. PMID 17571346. Retrieved 9 August 2020.
- ↑ Ya-Mei Wang, Ping Zhou, Li-Yong Wang, Zhen-Hua Li, Yao-Nan Zhang, and Yu-Xiang Zhang (10 August 2012). "Correlation Between DNase I Hypersensitive Site Distribution and Gene Expression in HeLa S3 Cells". PLoS One. 7 (8): e2414. doi:10.1371/journal.pone.0042414. PMID 22900019. Retrieved 9 August 2020.
- ↑ 5.0 5.1 5.2 5.3 5.4 5.5 5.6 5.7 5.8 5.9 Matthew J. Rossi, William K.M. Lai and B. Franklin Pugh (21 March 2018). "Genome-wide determinants of sequence-specific DNA binding of general regulatory factors". Genome Research. 28: 497–508. doi:10.1101/gr.229518.117. PMID 29563167. Retrieved 31 August 2020.
- ↑ MeSH (8 July 2008). "Response Elements". U.S. National Library of Medicine, 8600 Rockville Pike, Bethesda, MD 20894: National Institutes of Health, Health & Human Services. Retrieved 2 September 2020.
- ↑ 7.0 7.1 7.2 7.3 ZG E, YP Z, JH Zhou and L W (16 April 2014). "Roles of the bZIP gene family in rice". Genetics and Molecular Research. 13 (2): 3025–36. doi:10.4238/2014.April.16.11. PMID 24782137. Vancouver style error: punctuation (help)
- ↑ 8.0 8.1 RefSeq (November 2019). "LOC116286197 CRISPRi-validated cis-regulatory element chr19.6329 [ Homo sapiens (human) ]". 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 25 July 2020.
- ↑ RefSeq (February 2016). "ZNF582 zinc finger protein 582 [ Homo sapiens (human) ]". 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 28 May 2020.
- ↑ RefSeq (June 2018). "LOC112553117 Sharpr-MPRA regulatory region 1998 [ Homo sapiens (human) ]". 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 25 July 2020.
- ↑ RefSeq (June 2018). "Sharpr-MPRA regulatory region 10473 [ Homo sapiens (human) ]". 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 16 July 2020.
- ↑ RefSeq (June 2018). "Sharpr-MPRA regulatory region 7872 [ Homo sapiens (human) ]". 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 1 August 2020.
- ↑ RefSeq (June 2018). "Sharpr-MPRA regulatory region 9894 [ Homo sapiens (human) ]". 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 16 July 2020.
- ↑ 14.0 14.1 Tara L. Conforto, Yijing Zhang, Jennifer Sherman, and David J. Waxman (November 2012). "Impact of CUX2 on the Female Mouse Liver Transcriptome: Activation of Female-Biased Genes and Repression of Male-Biased Genes" (PDF). Molecular and Cellular Biology. 32 (22): 4611–4627. doi:10.1128/MCB.00886-12. PMID 22966202. Retrieved 8 August 2020.
- ↑ 15.0 15.1 15.2 Kirk A. Staschke, Souvik Dey, John M. Zaborske, Lakshmi Reddy Palam, Jeanette N. McClintick, Tao Pan, Howard J. Edenberg, and Ronald C. Wek (May 28, 2010). "Integration of General Amino Acid Control and Target of Rapamycin (TOR) Regulatory Pathways in Nitrogen Assimilation in Yeast" (PDF). The Journal of Biological Chemistry. 285 (22): 16893–16911. doi:10.1074/jbc.M110.121947. Retrieved 4 January 2021. line feed character in
|title=at position 104 (help) - ↑ 16.0 16.1 16.2 16.3 Kenneth A. Watanabe; Arielle Homayouni; Lingkun Gu; Kuan‐Ying Huang; Tuan‐Hua David Ho; Qingxi J. Shen (18 June 2017). "Transcriptomic analysis of rice aleurone cells identified a novel abscisic acid response element". Plant, Cell & Environment. 40 (9): 2004–2016. doi:10.1111/pce.13006. Retrieved 5 October 2020.
- ↑ Landschulz WH, Johnson PF, McKnight SL (June 1988). "The leucine zipper: a hypothetical structure common to a new class of DNA binding proteins". Science. 240 (4860): 1759–64. Bibcode:1988Sci...240.1759L. doi:10.1126/science.3289117. PMID 3289117.
- ↑ Nijhawan A, Jain M, Tyagi AK, Khurana JP (February 2008). "Genomic survey and gene expression analysis of the basic leucine zipper transcription factor family in rice". Plant Physiology. 146 (2): 333–50. doi:10.1104/pp.107.112821. PMID 18065552.
- ↑ Keiko Kokoroishi, Ayumu Nakashima, Shigehiro Doi, Toshinori Ueno, Toshiki Doi, Yukio Yokoyama, Kiyomasa Honda, Masami Kanawa, Yukio Kato, Nobuoki Kohno & Takao Masaki (28 May 2015). "High glucose promotes TGF-β1 production by inducing FOS expression in human peritoneal mesothelial cells". Clinical and Experimental Nephrology. 20 (1): 30–8. doi:10.1007/s10157-015-1128-9. PMID 26018137. Retrieved 14 August 2020.
- ↑ 20.0 20.1 20.2 20.3 20.4 20.5 20.6 20.7 Bhaskar Sharma; Joemar Taganna (12 June 2020). "Genome-wide analysis of the U-box E3 ubiquitin ligase enzyme gene family in tomato". Scientific Reports. 10 (9581). doi:10.1038/s41598-020-66553-1. PMID 32533036 Check
|pmid=value (help). Retrieved 27 August 2020. - ↑ 21.0 21.1 Dalei Shao, Caretha L. Creasy, Lawrence W. Bergman (1 February 1998). "A cysteine residue in helixII of the bHLH domain is essential for homodimerization of the yeast transcription factor Pho4p". Nucleic Acids Research. 26 (3): 710–4. doi:10.1093/nar/26.3.710. PMC 147311. PMID 9443961.
- ↑ 22.00 22.01 22.02 22.03 22.04 22.05 22.06 22.07 22.08 22.09 22.10 22.11 22.12 22.13 22.14 22.15 22.16 22.17 Hongting Tang, Yanling Wu, Jiliang Deng, Nanzhu Chen, Zhaohui Zheng, Yongjun Wei, Xiaozhou Luo, and Jay D. Keasling (6 August 2020). "Promoter Architecture and Promoter Engineering in Saccharomyces cerevisiae". Metabolites. 10 (8): 320–39. doi:10.3390/metabo10080320. PMID 32781665 Check
|pmid=value (help). Retrieved 18 September 2020. - ↑ 23.0 23.1 23.2 23.3 James R. Mitchell, Jeffrey Cheng, ang Kathleen Collins (January 1999). "A Box H/ACA Small Nucleolar RNA-Like Domain at the Human Telomerase RNA 3' End" (PDF). Molecular and Cellular Biology. 19 (1): 567–576. doi:10.1128/mcb.19.1.567. PMID 9858580. Retrieved 5 November 2018.
- ↑ 24.0 24.1 24.2 24.3 24.4 Young Hun Song; Cheol Min Yoo; An Pio Hong; Seong Hee Kim; Hee Jeong Jeong; Su Young Shin; Hye Jin Kim; Dae-Jin Yun; Chae Oh Lim; Jeong Dong Bahk; Sang Yeol Lee; Ron T. Nagao; Joe L. Key; Jong Chan Hong (April 2008). "DNA-Binding Study Identifies C-Box and Hybrid C/G-Box or C/A-Box Motifs as High-Affinity Binding Sites for STF1 and LONG HYPOCOTYL5 Proteins" (PDF). Plant Physiology. 146 (4): 1862–1877. doi:10.1104/pp.107.113217. PMID 18287490. Retrieved 26 March 2019.
- ↑ Takayuki Murata, Chieko Noda, Yohei Narita1, Takahiro Watanabe, Masahiro Yoshida, Keiji Ashio, Yoshitaka Sato, Fumi Goshima, Teru Kanda, Hironori Yoshiyama, Tatsuya Tsurumi, and Hiroshi Kimura (27 January 2016). "Induction of Epstein-Barr Virus Oncoprotein Latent Membrane Protein 1 (LMP1) by Transcription Factors Activating Protein 2 (AP-2) and Early B Cell Factor (EBF)" (PDF). Journal of Virology. doi:10.1128/JVI.03227-15. Retrieved 4 October 2020.
- ↑ Isabelle R. Cohen, Susanne Grässel, Alan D. Murdoch, and Renat V. Iozzo (1 November 1993). "Structural characterization of the complete human perlecan gene and its promoter" (PDF). Proceedings of the National Academy of Sciences USA. 90 (21): 10404–10408. doi:10.1073/pnas.90.21.10404. PMID 8234307. Retrieved 6 September 2020.
- ↑ Thomas D. Burton, Anthony O. Fedele, Jianling Xie, Lauren Sandeman and Christopher G. Proud (22 May 2020). "The gene for the lysosomal protein LAMP3 is a direct target of the transcription factor ATF4" (PDF). Journal of Biological Chemistry. 295 (21): 7418. doi:10.1074/jbc.RA119.011864. PMID 32312748 Check
|pmid=value (help). Retrieved 5 September 2020. - ↑ Tala Bakheet, Bryan R. G. Williams, and Khalid S. A. Khabar (1 January 2003). "ARED 2.0: an update of AU-rich element mRNA database". Nucleic Acids Research. 31 (1): 421–423. doi:10.1093/nar/gkg023. Retrieved 23 March 2021.
- ↑ 29.0 29.1 David A. Siegel, Olivier Le Tonqueze, Anne Biton, Noah Zaitlen, and David J. Erle (12 February 2020). "Massively Parallel Analysis of Human 3′ UTRs Reveals that AU-Rich Element Length and Registration Predict mRNA Destabilization" (PDF). bioRxiv. doi:10.1101/2020.02.12.945063. Retrieved 23 March 2021.
- ↑ 30.0 30.1 Michael Büttner and Karam B. Singh (May 27, 1997). "Arabidopsis thaliana ethylene-responsive element binding protein (AtEBP), an ethylene-inducible, GCC box DNA-binding protein interacts with an ocs element binding protein". Proceedings of the National Academy of Sciences of the United States of America. 94 (11): 5961–6. Retrieved 2014-05-02.
- ↑ S Kouhpayeh, AR Einizadeh, Z Hejazi, M Boshtam, L Shariati, M Mirian, L Darzi, M Sojoudi, H Khanahmad and A Rezaei (1 July 2016). "Antiproliferative effect of a synthetic aptamer mimicking androgen response elements in the LNCaP cell line" (PDF). Cancer Gene Therapy. 23: 254–257. doi:10.1038/cgt.2016.26. Retrieved 3 October 2020.
- ↑ 32.0 32.1 Stephen Wilson, Jianfei Qi & Fabian V. Filipp (14 September 2016). "Refinement of the androgen response element based on ChIP-Seq in androgen-insensitive and androgen-responsive prostate cancer cell lines". Scientific Reports. 6: 32611. doi:10.1038/srep32611. Retrieved 3 October 2020.
- ↑ Noriyuki Sato; Tomohiro Katsuya; Hiromi Rakugi; Seiju Takami; Yukiko Nakata; Tetsuro Miki; Jitsuo Higaki; Toshio Ogihara (September 1997). "Association of Variants in Critical Core Promoter Element of Angiotensinogen Gene With Increased Risk of Essential Hypertension in Japanese". Hypertension. 30 (3 Pt 1): 321–5. doi:10.1161/01.HYP.30.3.321. PMID 9314411. Retrieved 2012-02-20.
- ↑ Kazuyuki Yanai, Tomoko Saito, Keiko Hirota, Hideyuki Kobayashi, Kazuo Murakami and Akiyoshi Fukamizu (28 November 1997). "Molecular Variation of the Human Angiotensinogen Core Promoter Element Located between the TATA Box and Transcription Initiation Site Affects Its Transcriptional Activity". The Journal of Biological Chemistry. 272 (48): 30558–62. PMID 9374551. Retrieved 2012-02-20.
- ↑ Sarah E. Lacher; Daniel C. Levings; Samuel Freeman; Matthew Slattery (October 2018). "Identification of a functional antioxidant response element at the HIF1A locus". Redox Biology. 19: 401–411. doi:10.1016/j.redox.2018.08.014. Retrieved 6 October 2020.
- ↑ Stephen A. Liebhaber, Michel J. Goossens, and Yuet Wai Kan (December 1980). "Cloning and complete nucleotide sequence of human 5'-α-globin gene" (PDF). Proceedings of the National Academy of Science USA. 77 (12): 7054–8. Retrieved 2013-06-28.
- ↑ 37.0 37.1 37.2 37.3 Arnaud Stigliani, Raquel Martin-Arevalillo, Jérémy Lucas, Adrien Bessy, Thomas Vinos-Poyo, Victoria Mironova, Teva Vernoux, Renaud Dumas and François Parcy (3 June 2019). "Capturing Auxin Response Factors Syntax Using DNA Binding Models". Molecular Plant. 12 (6): 822–832. doi:10.1016/j.molp.2018.09.010. PMID 30336329. Retrieved 29 August 2020.
- ↑ 38.0 38.1 PA Johnson, D Bunick, NB Hecht (1991). "Protein Binding Regions in the Mouse and Rat Protamine-2 Genes" (PDF). Biology of Reproduction. 44 (1): 127–134. doi:10.1095/biolreprod44.1.127. PMID 2015343. Retrieved 6 April 2019.
- ↑ Amber Paratore Sanchez and Kumar Sharma (July 2009). "Transcription factors in the pathogenesis of diabetic nephropathy". Expert Reviews in Molecular Medicine. 11: e13. doi:10.1017/S1462399409001057. PMID 19397838. Retrieved 1 October 2018.
- ↑ 40.0 40.1 40.2 Takuya Matsumoto, Saemi Kitajima, Chisato Yamamoto, Mitsuru Aoyagi, Yoshiharu Mitoma, Hiroyuki Harada and Yuji Nagashima (9 August 2020). "Cloning and tissue distribution of the ATP-binding cassette subfamily G member 2 gene in the marine pufferfish Takifugu rubripes" (PDF). Fisheries Science. 86: 873–887. doi:10.1007/s12562-020-01451-z. Retrieved 27 September 2020.
- ↑ 41.0 41.1 41.2 Chuhu Yang, Eugene Bolotin, Tao Jiang, Frances M. Sladek, Ernest Martinez. (March 7, 2007). "Prevalence of the initiator over the TATA box in human and yeast genes and identification of DNA motifs enriched in human TATA-less core promoters". Gene. 389 (1): 52–65. doi:10.1016/j.gene.2006.09.029. PMID 17123746.
- ↑ Alan K. Kutach, James T. Kadonaga (July 2000). "The Downstream Promoter Element DPE Appears To Be as Widely Used as the TATA Box in Drosophila Core Promoters" (PDF). Molecular and Cellular Biology. 20 (13): 4754–64. PMID 10848601. Retrieved 2012-07-15.
- ↑ 43.0 43.1 43.2 Andreas Schlundt, Sophie Buchner, Robert Janowski, Thomas Heydenreich, Ralf Heermann, Jürgen Lassak, Arie Geerlof, Ralf Stehle, Dierk Niessing, Kirsten Jung & Michael Sattler (21 April 2017). "Structure-function analysis of the DNA-binding domain of a transmembrane transcriptional activator". Scientific Reports. 7: 1051. doi:10.1038/s41598-017-01031-9. PMID 28432336. Retrieved 28 August 2020.
- ↑ 44.0 44.1 44.2 44.3 44.4 44.5 44.6 Jianyin Long; Daniel L. Galvan; Koki Mise; Yashpal S. Kanwar; Li Li; Naravat Poungavrin; Paul A. Overbeek; Benny H. Chang; Farhad R. Danesh (28 May 2020). "Role for carbohydrate response element-binding protein (ChREBP) in high glucose-mediated repression of long noncoding RNA Tug1" (PDF). Journal of Biological Chemistry. 5 (28). doi:10.1074/jbc.RA120.013228. Retrieved 6 October 2020.
- ↑ 45.0 45.1 Liu-Min Fan, Xiaoyan Feng, Yu Wang and Xing Wang Deng (2007). "Gibberellin Signal Transduction in Rice". Journal of Integrative Plant Biology. 49 (6): 731−741. doi:10.1111/j.1744-7909.2007.00511.x. Retrieved 16 October 2018.
- ↑ Masaki Fujisawa, Toshitsugu Nakano, Yoko Shima and Yasuhiro Ito (5 February 2013). "A large-scale identification of direct targets of the tomato MADS box transcription factor RIPENING INHIBITOR reveals the regulation of fruit ripening". The Plant Cell. 25 (2): 371–86. doi:10.1105/tpc.112.108118. PMID 23386264. Retrieved 2017-02-19.
- ↑ 47.0 47.1 47.2 47.3 47.4 Weiwei Deng, Hua Ying, Chris A. Helliwell, Jennifer M. Taylor, W. James Peacock, and Elizabeth S. Dennis (19 April 2011). "FLOWERING LOCUS C (FLC) regulates development pathways throughout the life cycle of Arabidopsis". Proceedings of the National Academy of Sciences United States of America. 108 (16): 6680–6685. doi:10.1073/pnas.1103175108. Retrieved 2017-09-17.
- ↑ 48.0 48.1 Christof Berberich, Ingolf Dürr, Michael Koenen and Veit Witzemann (September 1993). "Two adjacent E box elements and a M‐CAT box are involved in the muscle‐specific regulation of the rat acetylcholine receptor β subunit gene". European Journal of Biochemistry. 216 (2): 395–404. doi:10.1111/j.1432-1033.1993.tb18157.x. Retrieved 27 December 2019.
- ↑ 49.0 49.1 E. N. Voronina, T. D. Kolokol’tsova, E. A. Nechaeva, and M. L. Filipenko (2003). "Structural–Functional Analysis of the Human Gene for Ribosomal Protein L11" (PDF). Molecular Biology. 37 (3): 362–371. Retrieved 11 April 2019.
- ↑ 50.0 50.1 Dmitry A. Samarsky, Maurille J.Fournier, Robert H.Singer and Edouard Bertrand (1 July 1998). "The snoRNA box C/D motif directs nucleolar targeting and also couples snoRNA synthesis and localization" (PDF). The European Molecular Biology Organization (EMBO) Journal. 17 (13): 3747–3757. doi:10.1093/emboj/17.13.3747. PMID 9649444. Retrieved 2017-02-04.
- ↑ Joanna Deckert, Natasha Taranenko, and Peter M. Gresshoff (1994). Peter M. Gresshoff, ed. Cell Cycle Genes and Their Plant Homologues, In: Plant Genome Analysis: Current Topics in Plant Molecular Biology. 2000 Corporate Blvd., N.W., Boca Raton, Florida 33431: CRC Press, Inc. pp. 169–194. ISBN 0-8493-8264-5. Retrieved 19 April 2021.
- ↑ Wei Wei, Yang Hu, Meng-Yuan Cui, Yong-Tao Han, Kuan Gao, and Jia-Yue Feng (22 December 2016). "Identification and Transcript Analysis of the TCP Transcription Factors in the Diploid Woodland Strawberry Fragaria vesca". Frontiers in Plant Science. 7: 1937. doi:10.3389/fpls.2016.01937. PMID 28066489. Retrieved 29 November 2020.
- ↑ 53.0 53.1 53.2 53.3 María C. Leal, Ezequiel I. Surace, María P. Holgado, Carina C. Ferrari, Rodolfo Tarelli, Fernando Pitossi, Thomas Wisniewski, Eduardo M. Castaño, and Laura Morelli (19 October 2011). "Notch signaling proteins HES-1 and Hey-1 bind to insulin degrading enzyme (IDE) proximal promoter and repress its transcription and activity: Implications for cellular Aβ metabolism". Biochim Biophys Acta. 1823 (2): 227–235. doi:10.1016/j.bbamcr.2011.09.014. PMID 22036964. Retrieved 21 March 2021.
- ↑ Björn Pietzenuk, Catarine Markus, Hervé Gaubert, Navratan Bagwan, Aldo Merotto, Etienne Bucher & Ales Pecinka (11 October 2016). "Recurrent evolution of heat-responsiveness in Brassicaceae COPIA elements". Genome Biology. 17: 209. doi:10.1186/s13059-016-1072-3. Retrieved 14 September 2020.
- ↑ 55.0 55.1 Jeanette M. Quinn, Paola Barraco, Mats Eriksson and Sabeeha Merchant (March 2000). "Coordinate Copper- and Oxygen-responsive Cyc6 and Cpx1 Expression in Chlamydomonas Is Mediated by the Same Element". Journal of Biological Chemistry. 275 (9): 6080–6089. doi:10.1074/jbc.275.9.6080. Retrieved 1 April 2021.
- ↑ Yong-Sung Park, Tae-Hyoung Kim and Cheol-Won Yun (3 July 2017). "Functional characterization of the copper transcription factor AfMac1 from Aspergillus fumigatus". Biochemical Journal. 474 (14): 2365–2378. doi:10.1042/BCJ20170191. Retrieved 2 April 2021.
- ↑ Shuangcheng Ding, Fengyu He, Wenlin Tang, Hewei Du and Hongwei Wang (12 August 2019). "Identification of Maize CC-Type Glutaredoxins That Are Associated with Response to Drought Stress". Genes. 10 (610): 1–15. doi:10.3390/genes10080610. Retrieved 30 November 2020.
- ↑ 58.0 58.1 Marc R. Montminy, Kevin A. Sevarino, John A. Wagner, Gail Mandel, and Richard H. Goodman (September 1986). "Identification of a cyclic-AMP-responsive element within the rat somatostatin gene" (PDF). Proceedings of the National Academy of Sciences of the USA. 83 (18): 6382–6. PMID 2875459. Retrieved 17 September 2018.
- ↑ 59.0 59.1 59.2 Mingtang Xie1, Hongyu Chen, Ling Huang, Ryan C. O’Neil1, Maxim N. Shokhirev & Joseph R. Ecker (23 April 2018). "A B-ARR-mediated cytokinin transcriptional network directs hormone cross-regulation and shoot development" (PDF). Nature Communications. 9 (1604): 1–13. doi:10.1038/s41467-018-03921-6. Retrieved 26 April 2021.
- ↑ Andrew C Lin, Chin Lik Tan, Chien-Ling Lin, Laure Strochlic, Yi-Shuian Huang, Joel D Richter & Christine E Holt (2 March 2009). "Cytoplasmic polyadenylation and cytoplasmic polyadenylation element-dependent mRNA regulation are involved in Xenopus retinal axon development". Neural Development. 4: 8. doi:10.1186/1749-8104-4-8.
|access-date=requires|url=(help) - ↑ Maria Ivshina, Paul Lasko, and Joel D. Richter (October 2014). "Cytoplasmic polyadenylation element binding proteins in development, health, and disease". Annual Review of Cell and Developmental Biology. 30: 393–415. doi:10.1146/annurev-cellbio-101011-155831. Retrieved 17 April 2021.
- ↑ 62.0 62.1 Jun Li, Ana Carolina Dantas Machado, Ming Guo, Jared M. Sagendorf, Zhan Zhou, Longying Jiang, Xiaojuan Chen, Daichao Wu, Lingzhi Qu, Zhuchu Chen, Lin Chen, Remo Rohs, and Yongheng Chen (25 July 2017). "Structure of the forkhead domain of FOXA2 bound to a complete DNA consensus site". Biochemistry. 56 (29): 3745–3753. doi:10.1021/acs.biochem.7b00211. PMID 28644006. Retrieved 28 August 2020.
- ↑ 63.0 63.1 63.2 63.3 63.4 63.5 Masaru Motojima, Takao Ando and Toshimasa Yoshioka (10 July 2000). "Sp1-like activity mediates angiotensin-II-induced plasminogen-activator inhibitor type-1 (PAI-1) gene expression in mesangial cells" (PDF). Biomedical Journal. 349 (2): 435–441. doi:10.1042/0264-6021:3490435. PMID 10880342. Retrieved 13 August 2020.
- ↑ 64.0 64.1 Roberta A. Sumrada and Terrance G. Cooper (June 1987). "Ubiquitous upstream repression sequences control activation of the inducible arginase gene in yeast" (PDF). Proceedings of the National Academy of Sciences USA. 84: 3997–4001. doi:10.1073/pnas.84.12.3997. PMID 3295874. Retrieved 6 September 2020.
- ↑ 65.0 65.1 65.2 65.3 Dong-Hoon Lee, Naum Gershenzon, Malavika Gupta, Ilya P. Ioshikhes, Danny Reinberg and Brian A. Lewis (November 2005). "Functional Characterization of Core Promoter Elements: the Downstream Core Element Is Recognized by TAF1". Molecular and Cellular Biology. 25 (21): 9674–86. doi:10.1128/MCB.25.21.9674-9686.2005. PMID 16227614. Retrieved 2010-10-23.
- ↑ T.W. Burke and James T. Kadonaga (15 March 1996). "Drosophila TFIID binds to a conserved downstream basal promoter element that is present in many TATA-box-deficient promoters" (PDF). Genes & Development. 10 (6): 711–724. doi:10.1101/gad.10.6.711. PMID 8598298.
- ↑ James T. Kadonaga (September 2002). "The DPE, a core promoter element for transcription by RNA polymerase II" (PDF). Experimental & Molecular Medicine. 34 (4): 259–264. PMID 12515390.
- ↑ Tamar Juven-Gershon, James T. Kadonaga (March 15, 2010). "Regulation of Gene Expression via the Core Promoter and the Basal Transcriptional Machinery". Developmental Biology. 339 (2): 225–9. doi:10.1016/j.ydbio.2009.08.009. PMC 2830304. PMID 19682982.
- ↑ Cornelis Murre and David Baltimore (1992). "The Helix-Loop-Helix Motif: Structure and Function, In: Transcriptional Regulation". 22B. Cold Spring Harbor Laboratory Press: 861–79. doi:10.1101/087969425.22B.861. Retrieved 2017-02-08.
- ↑ 70.0 70.1 70.2 70.3 Kai Qiu, Zhongpeng Li, Zhen Yang, Junyi Chen, Shouxin Wu, Xiaoyu Zhu, Shan Gao, Jiong Gao, Guodong Ren, Benke Kuai, and Xin Zhou (July 2015). "EIN3 and ORE1 Accelerate Degreening during Ethylene-Mediated Leaf Senescence by Directly Activating Chlorophyll Catabolic Genes in Arabidopsis". PLoS Genetics. 11 (7): e1005399. doi:10.1371/journal.pgen.1005399. PMID 26218222. Retrieved 4 October 2020.
- ↑ 71.0 71.1 71.2 Jae-Seon So (31 August 2018). "Roles of Endoplasmic Reticulum Stress in Immune Responses". Molecules and Cells. 41 (8): 705–16. doi:10.14348/molcells.2018.0241. PMID 30078231. Retrieved 5 September 2020.
- ↑ Jaideep Chaudhary and Michael K. Skinner (May 1999). "Basic Helix-Loop-Helix Proteins Can Act at the E-Box within the Serum Response Element of the c-fos Promoter to Influence Hormone-Induced Promoter Activation in Sertoli Cells". Molecular Endocrinology. 13 (5): 774–86. doi:10.1210/me.13.5.774. PMID 10319327. Retrieved 2013-06-14.
- ↑ Catherine Terraz, Gaelle Brideau, Pierre Ronco and Jérôme Rossert (May 24, 2002). "A Combination of cis-Acting Elements Is Required to Activate the Pro-α1(I) Collagen Promoter in Tendon Fibroblasts of Transgenic Mice". The Journal of Biological Chemistry. 277 (21): 19019–26. doi:10.1074/jbc.M200125200. Retrieved 2013-02-13.
- ↑ Montaña Mena, Francisco Javier Cejudo, Ines Isabel-Lamoneda and Pilar Carbonero (1 September 2002). "A Role for the DOF Transcription Factor BPBF in the Regulation of Gibberellin-Responsive Genes in Barley Aleurone". Plant Physiology. 130 (1): 111–9. doi:10.1104/pp.005561. Retrieved 2017-02-19.
- ↑ 75.0 75.1 75.2 75.3 75.4 75.5 75.6 Zi-Wei Ye, Jie Xu, Jianxin Shi, Dabing Zhang and Mee-Len Chye (January 2017). "Kelch-motif containing acyl-CoA binding proteins AtACBP4 and AtACBP5 are differentially expressed and function in floral lipid metabolism" (PDF). Plant Molecular Biology. 93: 209–225. doi:10.1007/s11103-016-0557-5. PMID 27826761. Retrieved 7 May 2020.
- ↑ H Imataka, K Sogawa, KI Yasumoto, Y Kikuchi, K Sasano, A Kobayashi, M Hayami, and Y Fujii-Kuriyama (October 1992). "Two regulatory proteins that bind to the basic transcription element (BTE), a GC box sequence in the promoter region of the rat P-4501A1 gene" (PDF). The EMBO Journal. 11 (10): 3663–71. PMID 1356762. Retrieved 2013-01-27.
- ↑ Marcos Palavecino-Ruiz, Mariana Bermudez-Moretti and Susana Correa-Garcia (12 October 2017). "Unravelling the transcriptional regulation of Saccharomyces cerevisiae UGA genes: the dual role of transcription factor Leu3" (PDF). Microbiology. 163: 1692–1701. doi:10.1099/mic.0.000560. Retrieved 20 April 2021.
- ↑ Nanbiao Long, Thomas Orasch, Shizhu Zhang, Lu Gao, Xiaoling Xu, Peter Hortschansky, Jing Ye, Fenli Zhang, Kai Xu, Fabio Gsaller, Maria Straßburger, Ulrike Binder, Thorsten Heinekamp, Axel A. Brakhage, Hubertus Haas, Ling Lu (26 October 2018). "The Zn2Cys6-type transcription factor LeuB cross-links regulation of leucine biosynthesis and iron acquisition in Aspergillus fumigatus". PLOS Genetics. 14 (10): e1007762. doi:10.1371/journal.pgen.1007762. Retrieved 20 April 2021.
- ↑ Guck T. Ooi, Kelley R. Hurst, Matthew N. Poy, Matthew M. Rechler, Yves R. Boisclair (1 May 1998). "Binding of STAT5a and STAT5b to a Single Element Resembling a γ-Interferon-Activated Sequence Mediates the Growth Hormone Induction of the Mouse Acid-Labile Subunit Promoter in Liver Cells". Molecular Endocrinology. 12 (5): 675–687. doi:10.1210/mend.12.5.0115. PMID 9605930. Retrieved 9 September 2020.
- ↑ Nicholas V Parsonnet, Nickolaus C Lammer, Zachariah E Holmes, Robert T Batey, Deborah S Wuttke (5 September 2019). "The glucocorticoid receptor DNA-binding domain recognizes RNA hairpin structures with high affinity". Nucleic Acids Research. 47 (15): 8180–8192. doi:10.1093/nar/gkz486. PMID 31147715. Retrieved 28 August 2020.
- ↑ Hiroshi Sato, Megumi Kita, and Motoharu Seiki (5 November 1993). "v-Src Activates the Expression of 92-kDa Type IV Collagenase Gene through the AP-1 Site and the GT Box Homologous to Retinoblastoma Control Elements" (PDF). The Journal of Biological Chemistry. 268 (31): 23460–8. PMID 8226872. Retrieved 13 August 2020.
- ↑ Niwed Kullawong, Sutipa Tanapongpipat, Lily Eurwilaichitr and Witoon Tirasophon (2018). "Unfolded Protein Response (UPR) Induced Hybrid Promoters for Heterologous Gene Expression in Pichia pastoris" (PDF). Chiang Mai Journal of Science. 45 (7): 2554–2565. Retrieved 11 January 2021.
- ↑ Timofey S. Rozhdestvensky, Thean Hock Tang, Inna V. Tchirkova, Jürgen Brosius, Jean‐Pierre Bachellerie and Alexander Hüttenhofer (2003). "Binding of L7Ae protein to the K‐turn of archaeal snoRNAs: a shared RNA binding motif for C/D and H/ACA box snoRNAs in Archaea". Nucleic Acids Research. 31 (3): 869–77. doi:10.1093/nar/gkg175. Retrieved 2014-06-08.
- ↑ Laura C. Collopy, Tracy L. Ware, Tomas Goncalves, Sunnvør í Kongsstovu, Qian Yang, Hanna Amelina, Corinne Pinder, Ala Alenazi, Vera Moiseeva, Siân R. Pearson, Christine A. Armstrong & Kazunori Tomita (2018). "LARP7 family proteins have conserved function in telomerase assembly" (PDF). Nature Communications. 9 (557): 1–8. doi:10.1038/s41467-017-02296-4. Retrieved 1 August 2019.
- ↑ William P. Lindsay, Fiona M. McAlister, Qun Zhu, Xian-Zhi He, Wolfgang Dröge-Laser, Susie Hedrick, Peter Doerner, Chris Lamb and Richard A. Dixon (July 2002). "KAP-2, a protein that binds to the H-box in a bean chalcone synthase promoter, is a novel plant transcription factor with sequence identity to the large subunit of human Ku autoantigen". Plant Molecular Biology. 49 (5): 503–514. doi:10.1023/A:1015505316379. Retrieved 5 October 2019.
- ↑ Gary J. Loake, Ouriel Faktor, Christopher J. Lamb, and Richard A. Dixon (October 1992). "Combination of H-box [CCTACC(N)7CT] and G-box (CACGTG) cis elements is necessary for feed-forward stimulation of a chalcone synthase promoter by the phenylpropanoid-pathway intermediate p-coumaricacid" (PDF). Proceedings of the National Academy of Sciences USA. 89 (19): 9230–9234. doi:10.1073/pnas.89.19.9230. Retrieved 16 March 2021.
- ↑ 87.0 87.1 87.2 Dawn L. Eastmond and Hillary C. M. Nelson (October 27, 2006). "Genome-wide Analysis Reveals New Roles for the Activation Domains of the Saccharomyces cerevisiae Heat Shock Transcription Factor (Hsf1) during the Transient Heat Shock Response". Journal of Biological Chemistry. 281 (43): P32909–32921. doi:10.1074/jbc.M602454200. Retrieved 19 January 2021.
- ↑ Vincent Laudet, Dominique Stehelin and Hans Clevers (1993). "Ancestry and diversity of the HMG box superfamily" (PDF). Nucleic Acids Research. 21 (10): 2493–501. doi:10.1093/nar/21.10.2493. PMID 8506143. Retrieved 2017-04-05.
- ↑ RefSeq (April 2015). HNF1A HNF1 homeobox A [ Homo sapiens (human) ]. 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 7 November 2018.
- ↑ 90.0 90.1 Qingliang Li, Rezaul M. Karim, Mo Cheng, Mousumi Das, Lihong Chen, Chen Zhang, Harshani R. Lawrence, Gary W. Daughdrill, Ernst Schonbrunn, Haitao Ji and Jiandong Chen (July 2020). "Inhibition of p53 DNA binding by a small molecule protects mice from radiation toxicity". Oncogene. 39 (29): 5187–5200. doi:10.1038/s41388-020-1344-y. PMID 32555331 Check
|pmid=value (help). Retrieved 29 August 2020. - ↑ Cissi Gardmo and Agneta Mode (1 December 2006). "In vivo transfection of rat liver discloses binding sites conveying GH-dependent and female-specific gene expression". Journal of Molecular Endocrinology. 37 (3): 433–441. doi:10.1677/jme.1.02116. PMID 17170084. Retrieved 2017-09-01.
- ↑ Anna Kalousová, Vladimı́r Beneš, Jan Pačes, Václav Pačes and Zbyněk Kozmik (June 1999). "DNA Binding and Transactivating Properties of the Paired and Homeobox Protein Pax4". Biochemical and Biophysical Research Communications. 259 (3): 510–518. PMID 10364449. Retrieved 6 May 2020.
- ↑ G. Damante, D. Fabbro, L. Pelizari, D. Civitareale, S. Guazzi, M. Polycarpou-Schwartz, S. Cauci, F. Quadrifoglio, S. Formisano and R. Di Lauro (20 June 1994). "Sequence-specific DNA recognition by the thyroid transcription factor-1 homeodomain" (PDF). Nucleic Acids Research. 22 (15): 3075–83. doi:10.1093/nar/22.15.3075. PMID 7915030. Retrieved 6 May 2020.
- ↑ Ilaria M. C. Orlando, Véronique N. Lafleur, Federica Storti, Patrick Spielmann, Lisa Crowther, Sara Santambrogio, Johannes Schödel, David Hoogewijs, David R. Mole, and Roland H. Wenger (19 December 2019). "Distal and proximal hypoxia response elements co-operate to regulate organ-specific erythropoietin gene expression". Haematologica. 105 (12): 2774–2784. doi:10.3324/haematol.2019.236406. PMID 33256376 Check
|pmid=value (help). Retrieved 6 May 2021. - ↑ 95.0 95.1 Akiro Higashikawa, Taku Saito, Toshiyuki Ikeda, Satoru Kamekura, Naohiro Kawamura, Akinori Kan, Yasushi Oshima, Shinsuke Ohba, Naoshi Ogata, Katsushi Takeshita, Kozo Nakamura, Ung-Il Chung, Hiroshi Kawaguchi (January 2009). "Identification of the core element responsive to runt-related transcription factor 2 in the promoter of human type x collagen gene". Arthritis & Rheumatism. 60 (1): 166–78. doi:10.1002/art.24243. PMID 19116917. Retrieved 2013-06-18.
- ↑ Hualin Xi, Yong Yu, Yutao Fu, Jonathan Foley, Anason Halees, and Zhiping Weng (June 2007). "Analysis of overrepresented motifs in human core promoters reveals dual regulatory roles of YY1". Genome Research. 17 (6): 798–806. doi:10.1101/gr.5754707. PMC 1891339. PMID 17567998.
- ↑ Jennifer F. Kugel and James A. Goodrich (2017). "Finding the start site: redefining the human initiator element" (PDF). Genes & Development. 31 (1–2): 1. doi:10.1101/gad.295980.117. Retrieved 9 May 2019.
- ↑ Sabine Schwank, Ronald Ebbert, Karin Rautenstrau𝛃, Eckhart Schweizer and Hans-Joachim Schüller (25 January 1995). "Yeast transcriptional activator IN02 interacts as an Ino2p/Ino4p basic helix-loop-helix heteromeric complex with the inositol/choline responsive element necessary for expression of phospholipid biosynthetic genes in Saccharomyces cerevisiae" (PDF). Nucleic Acids Research. 23 (2): 230–37. doi:10.1093/nar/23.2.230. Retrieved 10 August 2020.
- ↑ Kendall C. Case, Michael Salsaa, Wenxi Yu and Miriam L. Greenberg (28 December 2018). Gomez-Cambronero J., Frohman M., ed. Regulation of Inositol Biosynthesis: Balancing Health and Pathophysiology, In: Lipid Signaling in Human Diseases. Handbook of Experimental Pharmacology, vol 259. Cham: Springer. pp. 221–260. doi:10.1007/164_2018_181. ISBN 978-3-030-33667-7. Retrieved 29 January 2021.
- ↑ John M. Lopes, Jeanne P. Hirsch, Patricia A. Chorgo, Karen L. Schulze and Susan A. Henry (April 11, 1991). "Analysis of sequences in the INOl promoter that are involved in its regulation by phospholipid precursors" (PDF). Nucleic Acids Research. 19 (7): 1687–1693. doi:10.1093/nar/19.7.1687. PMID 2027776. Retrieved 29 January 2021.
- ↑ Mengmeng Lu, Chuanyan Yang, Meijia Li, Qilin Yi, Guangxia Lu, Yichen Wu, Chen Qu, Lingling Wang, and Linsheng Song (May 2018). "A conserved interferon regulation factor 1 (IRF-1) from Pacific oyster Crassostrea gigas functioned as an activator of IFN pathway". Fish & Shellfish Immunology. 76 (May): 68–77. doi:10.1016/j.fsi.2018.02.024. Retrieved 27 March 2021.
- ↑ 102.0 102.1 Klaudia Kulczynska, James J. Bieker, Miroslawa Siatecka (12 February 2020). "A Krüppel-like factor 1 (KLF1) Mutation Associated with Severe Congenital Dyserythropoietic Anemia Alters Its DNA-Binding Specificity". Molecular and Cellular Biology. 40 (5): e00444–19. doi:10.1128/MCB.00444-19. PMID 31818881.
|access-date=requires|url=(help) - ↑ 103.0 103.1 103.2 Seungsoo Kim, Maitreya J Dunham, Jay Shendure (13 May 2019). "A combination of transcription factors mediates inducible interchromosomal contacts" (PDF). eLife. 8: e42499. doi:10.7554/eLife.42499.001. Retrieved 20 February 2021.
- ↑ 104.0 104.1 Herman A. de Boer, Lisa J. Comstock, and Mark Vasser (January 1983). "The tac promoter: A functional hybrid derived from the trp and lac promoters" (PDF). Proceedings of the National Academy of Sciences USA. 80 (1): 21–5. Retrieved 2017-02-19.
- ↑ Vera M. Ripoll, Nicholas A. Meadows, Liza-Jane Raggatt, Ming K. Chang, Allison R. Pettit, Alan I. Cassady and David A. Hume (30 April 2005). "Microphthalmia transcription factor regulates the expression of the novel osteoclast factor GPNMB" (PDF). Gene. 413 (1–2): 32–41. doi:10.1016/j.gene.2008.01.014. Retrieved 18 March 2021.
- ↑ Pierre‐Louis Blaiseau and Dominique Thomas (2 November 1998). "Multiple transcriptional activation complexes tether the yeast activator Met4 to DNA". The EMBO Journal. 17: 6327–6336. doi:10.1093/emboj/17.21.6327.
|access-date=requires|url=(help) - ↑ Sang Yoon Lee & Yoon Kwon Nam (3 July 2017). "Molecular cloning of metal-responsive transcription factor-1 (MTF-1) and transcriptional responses to metal and heat stresses in Pacific abalone, Haliotis discus hannai". Fisheries and Aquatic Sciences. 20: 9. doi:10.1186/s41240-017-0055-y. Retrieved 16 October 2020.
- ↑ 108.0 108.1 J. Branco, M. Ola, R. M. Silva, E. Fonseca, N. C. Gomes, C. Martins-Cruz, A. P. Silva, A. Silva-Dias, C. Pina-Vaz, C. Erraught, L. Brennan, A. G. Rodrigues, G. Butler and I. M. Miranda (August 2017). "Impact of ERG3 mutations and expression of ergosterol genes controlled by UPC2 and NDT80 in Candida parapsilosis azole resistance". Clinical Microbiology and Infection. 23 (8): 575.e1–575.e8. doi:10.1016/j.cmi.2017.02.002. PMID 28196695. Retrieved 5 September 2020.
- ↑ Nesrin Ozsarac, Melissa J. Straffon, Hazel E. Dalton, and Ian W. Dawes (March 1997). "Regulation of Gene Expression during Meiosis in Saccharomyces cerevisiae: SPR3 Is Controlled by both ABFI and a New Sporulation Control Element". Molecular and Cellular Biology. 17 (3): 1152–9. doi:10.1128/MCB.17.3.1152. PMC 231840. PMID 9032242.
- ↑ Sotirios‐Spyridon Vamvakas, John Kapolos, Lambros Farmakis, Gregoria Koskorellou, Fotios Genneos (14 May 2019). "Ser625 of msn2 transcription factor is indispensable for ethanol tolerance and alcoholic fermentation process". Biotechnology Progress. 35 (5): ee2837. doi:10.1002/btpr.2837. Retrieved 6 February 2021.
- ↑ Amanda Charlesworth, Anna Wilczynska, Prajitha Thampi, Linda L Cox, and Angus M MacNicol (21 June 2006). "Musashi regulates the temporal order of mRNA translation during Xenopus oocyte maturation". The EMBO Journal. 25 (12): 2792–2801. doi:10.1038/sj.emboj.7601159. PMID 16763568. Retrieved 17 April 2021.
- ↑ Siva Arumugam Saravanaperuma, Dario Pediconi, Carlo Renieri, Antonietta La Terza (15 June 2012). "Skipping of Exons by Premature Termination of Transcription and Alternative Splicing within Intron-5 of the Sheep SCF Gene: A Novel Splice Variant". PLOS ONE. 7 (6): e38657. doi:10.1371/journal.pone.0038657. Retrieved 17 April 2021.
- ↑ Tomoya Kotani, Kaori Maehata, Natsumi Takei (2017). "Regulation of Translationally Repressed mRNAs in Zebrafish and Mouse Oocytes, In: Oocytes. Results and Problems in Cell Differentiation". 63. Cham: Springer: 297–324. doi:10.1007/978-3-319-60855-6_13. Retrieved 17 April 2021.
- ↑ Paul J Rushton and Imre E Somssich (August 1998). "Transcriptional control of plant genes responsive to pathogens" (PDF). Current Opinion in Plant Biology. 1 (4): 311–5. doi:10.1016/1369-5266(88)80052-9. PMID 10066598. Retrieved 5 November 2018.
- ↑ 115.0 115.1 Potthoff MJ, Olson EN (December 2007). "MEF2: a central regulator of diverse developmental programs". Development. 134 (23): 4131–40. doi:10.1242/dev.008367. PMID 17959722.
- ↑ 116.0 116.1 116.2 Ayisha Zia, Muhammad Imran, and Sajid Rashid (7 February 2020). "In Silico Exploration of Conformational Dynamics and Novel Inhibitors for Targeting MEF2-Associated Transcriptional Activity". Journal of Chemical Information and Modeling. 60 (3): 1892–1909. doi:10.1021/acs.jcim.0c00008. Retrieved 10 September 2020.
- ↑ Nathalie Oulhen, S. Zachary Swartz, Jessica Laird, Alexandra Mascaro, Gary M. Wessel (1 February 2017). "Transient translational quiescence in primordial germ cells". Development. 144 (7): 1201. doi:10.1242/dev.144170. Retrieved 6 March 2021.
- ↑ Ruthrothaselvi Bharathavikru, Tatiana Dudnakova, Stuart Aitken, Joan Slight, Mara Artibani, Peter Hohenstein, David Tollervey and Nick Hastie (13 March 2017). "Transcription factor Wilms' tumor 1 regulates developmental RNAs through 3′ UTR interaction". Genes & Development. 31 (4): 347–352. doi:10.1101/gad.291500.116. Retrieved 6 March 2021.
- ↑ Kun Huang, Jin Li, Mikako Ito, Jun-Ichi Takeda, Bisei Ohkawara, Tomoo Ogi, Akio Masuda, and Kinji Ohno (8 September 2020). "Gene Expression Profile at the Motor Endplate of the Neuromuscular Junction of Fast-Twitch Muscle". Frontiers in Molecular Neuroscience. 13: 154–165. doi:10.3389/fnmol.2020.00154. PMID 33117128 Check
|pmid=value (help). Retrieved 19 March 2021. - ↑ Ge Bai, Da-Hai Yang, Peijian Chao, Heng Yao, MingLiang Fei, Yihan Zhang, Xuejun Chen, Bingguang Xiao, Feng Li, Zhen-Yu Wang, Jun Yang and He Xie (19 December 2020). "Genome-wide identification and expression analysis of NtbHLH gene family in tobacco (Nicotiana tabacum L.) and the role of NtbHLH86 in drought adaptation". Plant Diversity. 10: 4. doi:10.1016/j.pld.2020.10.004. Retrieved 19 March 2021.
- ↑ Min Gao, Yanxun Zhu, Jinhua Yang, Hongjing Zhang, Chenxia Cheng, Yucheng Zhang, Ran Wan, Zhangjun Fei & Xiping Wang (18 March 2019). "Identification of the grape basic helix–loop–helix transcription factor family and characterization of expression patterns in response to different stresses". Plant Growth Regulation. 88: 19–39. Retrieved 20 March 2021.
- ↑ Takahito Fukusumi, Theresa W. Guo, Shuling Ren, Sunny Haft, Chao Liu, Akihiro Sakai, Mizuo Ando, Yuki Saito, Sayed Sadat, and Joseph A. Califano (February 2021). "Reciprocal activation of HEY1 and NOTCH4 under SOX2 control promotes EMT in head and neck squamous cell carcinoma". International Journal of Oncology. 58 (2): 226–237. doi:10.3892/ijo.2020.5156. PMID 33491747 Check
|pmid=value (help). Retrieved 21 March 2021. - ↑ Margaret E Katz and Sarah Cooper (1 December 2015). "Extreme Diversity in the Regulation of Ndt80-Like Transcription Factors in Fungi". G3 Genes. 5 (12): 2783–2792. doi:10.1534/g3.115.021378. Retrieved 8 February 2021. Text "Genomes" ignored (help); Text "Genetics " ignored (help)
- ↑ Xu L, Ajimura M, Padmore R, Klein C, Kleckner N (December 1995). "NDT80, a meiosis-specific gene required for exit from pachytene in Saccharomyces cerevisiae". Molecular and Cellular Biology. 15 (12): 6572–81. doi:10.1128/MCB.15.12.6572. PMC 230910. PMID 8524222.
- ↑ Lamoureux JS, Stuart D, Tsang R, Wu C, Glover JN (November 2002). "Structure of the sporulation-specific transcription factor Ndt80 bound to DNA". The EMBO Journal. 21 (21): 5721–32. doi:10.1093/emboj/cdf572. PMC 131069. PMID 12411490.
- ↑ Hendrickson WA, Ward KB (October 1975). "Atomic models for the polypeptide backbones of myohemerythrin and hemerythrin". Biochemical and Biophysical Research Communications. 66 (4): 1349–56. doi:10.1016/0006-291x(75)90508-2. PMID 5.
- ↑ Shelley Chu and Ira Herskowitz (April 1, 1998). "Gametogenesis in Yeast Is Regulated by a Transcriptional Cascade Dependent on Ndt80". Molecular Cell. 1 (5): 685–96. doi:10.1016/S1097-2765(00)80068-4. PMID 9660952.
- ↑ Jugnu Jain, Emmanuel Burgeon, Tina M. Badalian, Patrick G. Hogan and Anjana Rao (24 February 1995). "A Similar DNA-binding Motif in NFAT Family Proteins and the Rel Homology Region" (PDF). Journal of Biological Chemistry. 270 (8): 4138–4145. doi:10.1074/jbc.270.8.4138. PMID 7876165. Retrieved 15 August 2020.
- ↑ Blomquist P, Belikov S, Wrange O (January 1999). "Increased nuclear factor 1 binding to its nucleosomal site mediated by sequence-dependent DNA structure". Nucleic Acids Research. 27 (2): 517–25. doi:10.1093/nar/27.2.517. PMC 148209. PMID 9862974.
- ↑ Walter F. Boron (2003). Medical Physiology: A Cellular And Molecular Approach. Elsevier/Saunders. pp. 125–126. ISBN 1-4160-2328-3.
- ↑ 131.0 131.1 D. W. Yao, J. Luo, Q. Y. He, J. Li, H. Wang, H. B. Shi, H. F. Xu, M. Wang and J. J. Loor (May 2016). "Characterization of the liver X receptor-dependent regulatory mechanism of goat stearoyl-coenzyme A desaturase 1 gene by linoleic acid". Journal of Dairy Science. 99 (5): 3945–3957. doi:10.3168/jds.2015-10601. PMID 26947306. Retrieved 5 September 2020.
- ↑ Alisa A. Garaeva, Irina E. Kovaleva, Peter M. Chumakov & Alexandra G. Evstafieva (15 January 2016). "Mitochondrial dysfunction induces SESN2 gene expression through Activating Transcription Factor 4". Cell Cycle. 15 (1): 64–71. doi:10.1080/15384101.2015.1120929. PMID 26771712. Retrieved 5 September 2020.
- ↑ Sinéad Kearns, Rudi Lurz, Elena V. Orlova, Andrei L. Okorokov (27 July 2016). "Two p53 tetramers bind one consensus DNA response element". Nucleic Acid Research. 44 (13): 6185–6199. doi:10.1093/nar/gkw215. Retrieved 6 October 2020.
- ↑ 134.0 134.1 Wangjie Yu and Paul E. Hardin (2006). "Circadian oscillators of Drosophila and mammals". Journal of Cell Science. 119: 4793–5. doi:10.1242/jcs.03174. PMID 17130292. Retrieved 2017-02-19.
- ↑ Elnaz Ghotbi, Kristina Lackey, Vicki Wong, Katie T. Thompson, Evan G. Caston, Minna Haddadi, Judith Benes and Richard S. Jones (1 March 2020). "Differential Contributions of DNA-Binding Proteins to Polycomb Response Element Activity at the Drosophila giant Gene" (PDF). Genetics. 214 (3): 623–634. doi:10.1534/genetics.119.302981. PMID 31919108. Retrieved 7 September 2020.
- ↑ Veronica Ruta, Chiara Longo, Andrea Lepri, Veronica De Angelis, Sara Occhigrossi, Paolo Costantino and Paola Vittorioso (8 February 2020). "The DOF Transcription Factors in Seed and Seedling Development". Plants. 9 (2): 218. doi:10.3390/plants9020218. Retrieved 7 January 2021.
- ↑ 137.0 137.1 137.2 M. Abiramavalli and B. Usha (7 July 2020). "Identification, characterization and expression analysis of sucrose transporters in the model plant Nicotiana tabacum cv.petit havana" (PDF). Journal of Environmental Biology. 41: 803–811. doi:10.22438/jeb/41/4/MRN-1233. Retrieved 7 January 2021.
- ↑ 138.0 138.1 Yao EF, Denison MS (June 1992). "DNA sequence determinants for binding of transformed Ah receptor to a dioxin-responsive enhancer". Biochemistry. 31 (21): 5060–7. doi:10.1021/bi00136a019. PMID 1318077.
- ↑ Jennifer A. Pietenpol, Karl Munger, Peter M. Howley, Roland W. Stein and Harold L. Moses (November 15, 1991). "Factor-binding element in the human c-myc promoter involved in transcriptional regulation by transforming growth factor β1 and by the retinoblastoma gene product" (PDF). Proceedings of the National Academy of Sciences USA. 88 (22): 10227–10231. doi:10.1073/pnas.88.22.10227. PMID 1946442. Retrieved 5 December 2018.
- ↑ 140.0 140.1 140.2 140.3 140.4 Hiroshi Sato, Megumi Kita, and Motoharu Seiki (5 November 1993). "v-Src Activates the Expression of 92-kDa Type IV Collagenase Gene through the AP-1 Site and the GT Box Homologous to Retinoblastoma Control Elements" (PDF). The Journal of Biological Chemistry. 268 (31): 23460–8. PMID 8226872. Retrieved 13 August 2020.
- ↑ Ashutosh Kumar, Himanshu N. Singh, Vikas Pareek, Khursheed Raza, Subrahamanyam Dantham, Pavan Kumar, Sankat Mochan and Muneeb A. Faiq (9 August 2016). "A Possible Mechanism of Zika Virus Associated Microcephaly: Imperative Role of Retinoic Acid Response Element (RARE) Consensus Sequence Repeats in the Viral Genome". Frontiers in Human Neuroscience. 10: 403. doi:10.3389/fnhum.2016.00403. PMID 27555815. Retrieved 7 September 2020.
- ↑ 142.0 142.1 142.2 Ruoyi Gu, Jun Xu, Yixiang Lin, Jing Zhang, Huijun Wang, Wei Sheng, Duan Ma, Xiaojing Ma & Guoying Huang (July 2016). "Liganded retinoic acid X receptor α represses connexin 43 through a potential retinoic acid response element in the promoter region". Pediatric Research. 80 (1): 159–168. doi:10.1038/pr.2016.47. PMID 26991262. Retrieved 7 September 2020.
- ↑ Junjian Wang, June X. Zou, Xiaoqian Xue, Demin Cai, Yan Zhang, Zhijian Duan, Qiuping Xiang, Joy C. Yang, Maggie C. Louie, Alexander D. Borowsky, Allen C. Gao, Christopher P. Evans, Kit S. Lam, Jianzhen Xu, Hsing-Jien Kung, Ronald M. Evans, Yong Xu, and Hong-Wu Chen (May 2016). "ROR-γ drives androgen receptor expression and represents a therapeutic target in castration-resistant prostate cancer". Nature Medicine. 22 (5): 488–496. doi:10.1038/nm.4070. PMID 27019329. Retrieved 6 September 2020.
- ↑ Ulrike Hartmann, Martin Sagasser, Frank Mehrtens, Ralf Stracke and Bernd Weisshaar (January 2005). "Differential combinatorial interactions of cis-acting elements recognized by R2R3-MYB, BZIP, and BHLH factors control light-responsive and tissue-specific activation of phenylpropanoid biosynthesis genes" (PDF). Plant Molecular Biology. 57 (2): 155–171. doi:10.1007/s11103-004-6910-0. PMID 15821875. Retrieved 10 November 2018.
- ↑ 145.0 145.1 Ravi P. Misra; Azad Bonni; Cindy K. Miranti; Victor M. Rivera; Morgan Sheng; Michael E.Greenberg (14 October 1994). "L-type Voltage-sensitive Calcium Channel Activation Stimulates Gene Expression by a Serum Response Factor-dependent Pathway" (PDF). The Journal of Biological Chemistry. 269 (41): 25483–25493. PMID 7929249. Retrieved 7 December 2019.
- ↑ John P. Cogswell, Patricia V. Basta, and Jenny P.-Y. Ting (October 1990). "X-box-binding proteins positively and negatively regulate transcription of the HLA-DRA gene through interaction with discrete upstream W and V elements" (PDF). Proceedings of the National Academy of Sciences USA. 87 (19): 7703–7707. doi:10.1073/pnas.87.19.7703. PMID 2120707. Retrieved 20 August 2020.
- ↑ 147.0 147.1 Julien J. Ghislain, Thomas Wong, Melody Nguyen, and Eleanor N. Fish (June 2001). "The Interferon-Inducible Stat2:Stat1 Heterodimer Preferentially Binds In Vitro to a Consensus Element Found in the Promoters of a Subset of Interferon-Stimulated Genes" (PDF). Journal of Interferon and Cytokine Research. 21 (6): 379–388. doi:10.1089/107999001750277. PMID 11440635. Retrieved 15 August 2020.
- ↑ Joanna Wesoly, Zofia Szweykowska-Kulinska and Hans A R Bluyssen (31 March 2007). "STAT activation and differential complex formation dictate selectivity of interferon responses". Acta Biochimica Polonica. 54 (1): 27–38. doi:10.18388/abp.2007_3266. PMID 17351669. Retrieved 15 August 2020.
- ↑ Fernanda M. Rodríguez-Tornos, Iñigo San Aniceto, Beatriz Cubelos, Marta Nieto (31 January 2013). "Enrichment of Conserved Synaptic Activity-Responsive Element in Neuronal Genes Predicts a Coordinated Response of MEF2, CREB and SRF". PLoS ONE. 8 (1): e53848. doi:10.1371/journal.pone.0053848. PMID 23382855. Retrieved 12 November 2018.
- ↑ Francisco Rivero (June 2002). "mRNA processing in Dictyostelium: sequence requirements for termination and splicing" (PDF). Protist. 153 (2): 169–76. doi:10.1078/1434-4610-00095. PMID 12125758. Retrieved 2017-04-05.
- ↑ Rodrigo Nunes da Fonseca and Thiago M. Venancio (1 March 2018). "Maternal or zygotic: Unveiling the secrets of the Pancrustacea transcription factor zelda". Plos Genetics. 14 (3): e1007201. doi:10.1371/journal.pgen.1007201. PMID 29494591. Retrieved 5 September 2020.
- ↑ Frank L. Conlon, Lynne Fairclough, Brenda M. J. Price, Elena S. Casey and J. C. Smith (2001). "Determinants of T box protein specificity" (PDF). Development. 128 (19): 3749–3758. PMID 11585801. Retrieved 17 November 2018.
- ↑ Ce Feng Liu, Gabriel S. Brandt, Quyen Q. Hoang, Natalia Naumova, Vanja Lazarevic, Eun Sook Hwang, Job Dekker, Laurie H. Glimcher, Dagmar Ringe, and Gregory A. Petsko (25 October 2016). "Crystal structure of the DNA binding domain of the transcription factor T-bet suggests simultaneous recognition of distant genome sites". Proceedings of the National Academy of Sciences of the USA. 113 (43): E6572–E6581. doi:10.1073/pnas.1613914113. PMID 27791029. Retrieved 28 August 2020.
- ↑ 154.0 154.1 Anja Schweizer, Steffen Rupp, Brad N. Taylor, Martin Röllinghoff, Klaus Schröppel (November 2000). "The TEA/ATTS transcription factor CaTec1p regulates hyphal development and virulence in Candida albicans". Molecular Microbiology. 38 (3): 435–445. doi:10.1046/j.1365-2958.2000.02132.x. Retrieved 21 April 2021.
- ↑ Yoshiro Maru (2016). Basic Research, In: "Inflammation and Metastasis". Tokyo: Springer. pp. 193–231. doi:10.1007/978-4-431-56024-1_10. ISBN 978-4-431-56022-7. Retrieved 28 August 2020.
- ↑ Vitor M S Pinto, Svetlana Minakhina, Shuiqing Qiu, Aniket Sidhaye, Michael P Brotherton, Amy Suhotliv, Fredric E Wondisford (1 September 2017). "Naturally Occurring Amino Acids in Helix 10 of the Thyroid Hormone Receptor Mediate Isoform-Specific TH Gene Regulation". Endocrinology. 158 (9): 3067–3078. doi:10.1210/en.2017-00314. PMID 28911178. Retrieved 5 September 2020.
- ↑ Henthorn P, McCarrick-Walmsley R, Kadesch T (February 1990). "Sequence of the cDNA encoding ITF-1, a positive-acting transcription factor". Nucleic Acids Research. 18 (3): 677. doi:10.1093/nar/18.3.677. PMID 2308859.
- ↑ Kamps MP, Murre C, Sun XH, Baltimore D (February 1990). "A new homeobox gene contributes the DNA binding domain of the t(1;19) translocation protein in pre-B ALL". Cell. 60 (4): 547–55. doi:10.1016/0092-8674(90)90658-2. PMID 1967983.
- ↑ E proteins and Notch signaling cooperate to promote T cell lineage specification and commitment
- ↑ Piskacek S (2007). "Nine-amino-acid transactivation domain: Establishment and prediction utilities". Genomics. 89 (6): 756–768. doi:10.1016/j.ygeno.2007.02.003. PMID 17467953.
- ↑ Piskacek, Martin; Vasku, A; Hajek, R; Knight, A (2015). "Shared structural features of the 9aaTAD family in complex with CBP". Mol. Biosyst. 11 (3): 844–851. doi:10.1039/c4mb00672k. PMID 25564305.
- ↑ RefSeq (September 2011). "TCF3 transcription factor 3 [ Homo sapiens (human) ]". 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 22 November 2020.
- ↑ 163.0 163.1 Tomomi M. Yamamoto, Jonathan M. Cook, Cassandra V. Kotter, Terry Khat, Kevin D. Silva, Michael Ferreyros, Justin W. Holt, Jefferson D. Knight, and Amanda Charlesworth (October 2013). "Zar1 represses translation in Xenopus oocytes and binds to the TCS in maternal mRNAs with different characteristics than Zar2". Biochim Biophys Acta. 1829 (10): 1034–46. doi:10.1016/j.bbagrm.2013.06.001. PMID 23827238. Retrieved 19 April 2021.
- ↑ 164.0 164.1 164.2 164.3 Martin L. Read, Andrew R. Clark and Kevin Docherty (1993). "The helix-loop-helix transcription factor USF (upstream stimulating factor) binds to a regulatory sequence of the human insulin gene enhancer" (PDF). Biochemical Journal. 295: 233–237. doi:10.1042/bj2950233. PMID 8216223. Retrieved 14 August 2020.
- ↑ Majid Pahlevan Kakhki, Abbas Nikravesh, Zeinab Shirvani Farsani, Mohammad Ali Sahraian, Mehrdad Behmanesh (April 2018). "HOTAIR but not ANRIL long non‐coding RNA contributes to the pathogenesis of multiple sclerosis". Immunology. 153 (4): 479–487. doi:10.1111/imm.12850. Retrieved 8 March 2021.
- ↑ Thomas Eulgem and Imre E Somssich (2007). "Networks of WRKY transcription factors in defense signaling" (PDF). Current Opinion in Plant Biology. 10: 366–371. doi:10.1016/j.pbi.2007.04.020. Retrieved 17 October 2018.
- ↑ Rushton, Paul; Macdonald, H.; Huttly, A.K.; Lazarus, C.M.; Hooley, R (1995). "Members of a new family of DNA-binding proteins bind to a conserved cis-element in the promoters of alpha-Amy2 genes". Plant Molecular Biology. 29: 691–702. doi:10.1007/bf00041160. PMID 8541496.
- ↑ Rushton PJ, Somssich IE, Ringler P, Shen QJ (May 2010). "WRKY transcription factors". Trends Plant Science. 15 (5): 247–58. doi:10.1016/j.tplants.2010.02.006. PMID 20304701.
- ↑ Yumiko Tokusumi, Ying Ma, Xianzhou Song, Raymond H. Jacobson, and Shinako Takada (March 2007). "The New Core Promoter Element XCPE1 (X Core Promoter Element 1) Directs Activator-, Mediator-, and TATA-Binding Protein-Dependent but TFIID-Independent RNA Polymerase II Transcription from TATA-Less Promoters". Molecular and Cellular Biology. 27 (5): 1844–58. doi:10.1128/MCB.01363-06. PMID 17210644. Retrieved 2013-02-09.
- ↑ Shen ES, Whitlock JP (April 1992). "Protein-DNA interactions at a dioxin-responsive enhancer. Mutational analysis of the DNA-binding site for the liganded Ah receptor". The Journal of Biological Chemistry. 267 (10): 6815–9. PMID 1313023.
- ↑ Lusska A, Shen E, Whitlock JP (March 1993). "Protein-DNA interactions at a dioxin-responsive enhancer. Analysis of six bona fide DNA-binding sites for the liganded Ah receptor". The Journal of Biological Chemistry. 268 (9): 6575–80. PMID 8384216.
- ↑ Wharton KA, Franks RG, Kasai Y, Crews ST (December 1994). "Control of CNS midline transcription by asymmetric E-box-like elements: similarity to xenobiotic responsive regulation". Development. 120 (12): 3563–9. PMID 7821222.
- ↑ Bacsi SG, Reisz-Porszasz S, Hankinson O (March 1995). "Orientation of the heterodimeric aryl hydrocarbon (dioxin) receptor complex on its asymmetric DNA recognition sequence". Molecular Pharmacology. 47 (3): 432–8. PMID 7700240.
- ↑ Swanson HI, Chan WK, Bradfield CA (November 1995). "DNA binding specificities and pairing rules of the Ah receptor, ARNT, and SIM proteins". The Journal of Biological Chemistry. 270 (44): 26292–302. doi:10.1074/jbc.270.44.26292. PMID 7592839.
- ↑ Boutros PC, Moffat ID, Franc MA, Tijet N, Tuomisto J, Pohjanvirta R, Okey AB (August 2004). "Dioxin-responsive AHRE-II gene battery: identification by phylogenetic footprinting". Biochemical and Biophysical Research Communications. 321 (3): 707–15. doi:10.1016/j.bbrc.2004.06.177. PMID 15358164.
- ↑ Sogawa K, Numayama-Tsuruta K, Takahashi T, Matsushita N, Miura C, Nikawa J, Gotoh O, Kikuchi Y, Fujii-Kuriyama Y (June 2004). "A novel induction mechanism of the rat CYP1A2 gene mediated by Ah receptor-Arnt heterodimer". Biochemical and Biophysical Research Communications. 318 (3): 746–55. doi:10.1016/j.bbrc.2004.04.090. PMID 15144902.
- ↑ Lisete Fernandes, Claudina Rodrigues-Pousada, Kevin Struhl (December 1997). "Yap, a novel family of eight bZIP proteins in Saccharomyces cerevisiae with distinct biological functions". Molecular and Cellular Biology. 17 (12): 6982–6993. doi:10.1128/MCB.17.12.6982. Retrieved 11 March 2021.
- ↑ Jakob Mejlvang, Marina Kriajevska, Cindy Vandewalle, Tatyana Chernova, A. Emre Sayan, Geert Berx, J. Kilian Mellon, and Eugene Tulchinsky (November 2007). "Direct Repression of Cyclin D1 by SIP1 Attenuates Cell Cycle Progression in Cells Undergoing an Epithelial Mesenchymal Transition". Molecular Biology of the Cell. 18 (11): 4615–4624. doi:10.1091/mbc.e07-05-0406. PMID 17855508. Retrieved 15 November 2018.
External links[edit | edit source]
EncycloReader
is supported by the 
KSF