Synaptic Activity-Responsive Elements

From Wikidoc - Reading time: 11 min


Associate Editor(s)-in-Chief: Henry A. Hoff

File:1N6J.png
Dimeric structure of the MADS (red) and MEF2 (green) domains of the human MEF2B transcription factor complexed with DNA (orange) based on the PDB:1N6J crystallographic coordinates. Credit: Boghog2.
File:MEF2 schematic.png
The domain organization and sequence comparison of Mef2 proteins from representative species.[1] The amino acid numbering shown is of the human MEF2A sequence and the per cent sequence identities are all relative to hMEF2A. The three domain, MADS (red), MEF2 (green), and transactivation domains (TAD; cyan) are each highlighted in a different color. Credit: Boghog2.

"A unique synaptic activity-responsive element (SARE) sequence, composed of the consensus binding sites for SRF, MEF2 and CREB, is necessary for control of transcriptional upregulation of the Arc gene in response to synaptic activity."[2]

CREBs

[edit | edit source]

"The Ca2+/cAMP response element-binding protein (CREB) was initially identified as the main interlocutor in the dialogue between the synapse and the nucleus [1]."[2]

MEF2s

[edit | edit source]

"MEF2 [is a transcription factor] necessary for long-term memory consolidation and storage."[2]

Myocyte enhancer factor-2 (MEF2) proteins are a family of transcription factors which through control of gene expression are important regulators of cellular differentiation and consequently play a critical role in embryonic development.[1] In adult organisms, Mef2 proteins mediate the stress response in some tissues.[1]

The "serum response factor SRF [is a transcription factor] necessary for long-term memory consolidation and storage."[2]

The serum response factor (SRF) is a transcription factor protein that binds to the c-fos serum response element (SRE).[3]

The serum response factor is a member of the MADS-box (MCM1, Agamous, Deficiens, and SRF) box superfamily of transcription factors,[4] binding to the serum response element (SRE) in the promoter region of target genes. This protein regulates the activity of many immediate early genes, for example c-fos, and thereby participates in cell cycle regulation, apoptosis, cell growth, and cell differentiation, is the downstream target of many pathways; for example, the mitogen-activated protein kinase pathway (MAPK) that acts through the ternary complex factors (TCFs).[5][6]

SRF is important during the development of the embryo, as it has been linked to the formation of mesoderm.[7][8] In the fully developed mammal, SRF is crucial for the growth of skeletal muscle.[9] Interaction of SRF with other proteins, such as steroid hormone receptors, may contribute to regulation of muscle growth by steroids.[10]

Consensus sequences

[edit | edit source]

cAMP/response elements (CREs)

[edit | edit source]

"Each species' promoter contains a cAMP/response element (CRE)1 consensus sequence ([11]) upstream of a TATA box. Two other members of this family of proteins, chromogranin B and secretogranin II (also known as chromogranin C), contain similar CRE and TATA homologies in their proximal gene promoters (8, 9)."[12]

"Within the cAMP-responsive element of the somatostatin gene, we observed an 8-base palindrome, 5'-TGACGTCA-3', which is highly conserved in many other genes whose expression is regulated by cAMP."[11]

Myocyte enhancer factor 2 (MEF2)

[edit | edit source]

"The current study delineates the conformational paradigm, clustered recognition, and comparative DNA binding preferences for MEF2A and MEF2B-specific MADS-box/MEF2 domains at the YTA(A/T)4TAR consensus motif."[13] Y = (C/T) and R = (A/G). The consensus sequence is (C/T)TA(A/T)(A/T)(A/T)(A/T)TA(A/G).[13]

Serum response elements (SRE)

[edit | edit source]

Serum response factor is a member of the MADS (MCM1, Agamous, Deficiens, and SRF) box superfamily of transcription factors.[4] This protein binds to the serum response element (SRE) in the promoter region of target genes.

The SRE wild type (SREwt) contains the nucleotide sequence ACAGGATGTCCATATTAGGACATCTGC, of which CCATATTAGG is the CArG box, TTAGGACAT is the C/EBP box, and CATCTG is the E box.[14]

Synaptic activity-responsive element samplings

[edit | edit source]

Copying each of the consensus sequences and putting the sequence in "⌘F" or from running the computer programs finds one MEF2 (CTAATTTTAA) between ZNF497 and A1BG or 5'-TGACGTCA-3' at 4317 between ZSCAN22 and A1BG, 5'-CCATATTAGG-3' is a CArG box that does not occur in either promoter of A1BG, TTAGGACAT is a C/EBP box that does not occur in either promoter, as can be found by the computer programs.

See serum response elements results for ACAGGATGT, Myocyte enhancer factor 2 (MEF2) results, CArG boxes results, and CREB results.

Acknowledgements

[edit | edit source]

The content on this page was first contributed by: Henry A. Hoff.

Initial content for this page in some instances came from Wikiversity.

See also

[edit | edit source]

References

[edit | edit source]
  1. 1.0 1.1 1.2 Potthoff MJ, Olson EN (December 2007). "MEF2: a central regulator of diverse developmental programs". Development. 134 (23): 4131–40. doi:10.1242/dev.008367. PMID 17959722.
  2. 2.0 2.1 2.2 2.3 Fernanda M. Rodríguez-Tornos, Iñigo San Aniceto, Beatriz Cubelos, Marta Nieto (31 January 2013). "Enrichment of Conserved Synaptic Activity-Responsive Element in Neuronal Genes Predicts a Coordinated Response of MEF2, CREB and SRF". PLoS ONE. 8 (1): e53848. doi:10.1371/journal.pone.0053848. Retrieved 12 November 2018.
  3. Norman C, Runswick M, Pollock R, Treisman R (December 1988). "Isolation and properties of cDNA clones encoding SRF, a transcription factor that binds to the c-fos serum response element". Cell. 55 (6): 989–1003. doi:10.1016/0092-8674(88)90244-9. PMID 3203386.
  4. 4.0 4.1 Shore P, Sharrocks AD (April 1995). "The MADS-box family of transcription factors". Eur. J. Biochem. 229 (1): 1–13. doi:10.1111/j.1432-1033.1995.0001l.x. PMID 7744019.
  5. Dalton S, Marais R, Wynne J, Treisman R (June 1993). "Isolation and characterization of SRF accessory proteins". Philos. Trans. R. Soc. Lond. B Biol. Sci. 340 (1293): 325–32. doi:10.1098/rstb.1993.0074. PMID 8103935.
  6. SRF serum response factor. National Center for Biotechnology Information, National Institutes of Health.
  7. Sepulveda JL, Vlahopoulos S, Iyer D, Belaguli N, Schwartz RJ (July 2002). "Combinatorial expression of GATA4, Nkx2-5, and serum response factor directs early cardiac gene activity". J. Biol. Chem. 277 (28): 25775–82. doi:10.1074/jbc.M203122200. PMID 11983708.
  8. Barron MR, Belaguli NS, Zhang SX, Trinh M, Iyer D, Merlo X, Lough JW, Parmacek MS, Bruneau BG, Schwartz RJ (March 2005). "Serum response factor, an enriched cardiac mesoderm obligatory factor, is a downstream gene target for Tbx genes". J. Biol. Chem. 280 (12): 11816–28. doi:10.1074/jbc.M412408200. PMID 15591049.
  9. Li S, Czubryt MP, McAnally J, Bassel-Duby R, Richardson JA, Wiebel FF, Nordheim A, Olson EN (January 2005). "Requirement for serum response factor for skeletal muscle growth and maturation revealed by tissue-specific gene deletion in mice". Proc. Natl. Acad. Sci. U.S.A. 102 (4): 1082–7. doi:10.1073/pnas.0409103102. PMC 545866. PMID 15647354.
  10. Vlahopoulos S, Zimmer WE, Jenster G, Belaguli NS, Balk SP, Brinkmann AO, Lanz RB, Zoumpourlis VC, Schwartz RJ (March 2005). "Recruitment of the androgen receptor via serum response factor facilitates expression of a myogenic gene". J. Biol. Chem. 280 (9): 7786–92. doi:10.1074/jbc.M413992200. PMID 15623502.
  11. 11.0 11.1 Marc R. Montminy, Kevin A. Sevarino, John A. Wagner, Gail Mandel, and Richard H. Goodman (September 1986). "Identification of a cyclic-AMP-responsive element within the rat somatostatin gene" (PDF). Proceedings of the National Academy of Sciences of the USA. 83 (18): 6382–6. Retrieved 17 September 2018.
  12. Hongjiang Wu, Sushil K. Mahata, Manjula Mahata, Nicholas J. G. Webster, Robert J. Parmer, and Daniel T. O'Connor (1 July 1995). "A Functional Cyclic AMP Response Element Plays a Crucial Role in Neuroendocrine Cell Type-specific Expression of the Secretory Granule Protein Chromogranin A". The Journal of Clinical Investigation. 96 (1): 568–578. doi:10.1172/JCI118069. Retrieved 17 September 2018.
  13. 13.0 13.1 Ayisha Zia, Muhammad Imran, and Sajid Rashid (7 February 2020). "In Silico Exploration of Conformational Dynamics and Novel Inhibitors for Targeting MEF2-Associated Transcriptional Activity". Journal of Chemical Information and Modeling. 60 (3): 1892–1909. doi:10.1021/acs.jcim.0c00008. Retrieved 10 September 2020.
  14. Ravi P. Misra, Azad Bonni, Cindy K. Miranti, Victor M. Rivera, Morgan Sheng, and Michael E.Greenberg (14 October 1994). "L-type Voltage-sensitive Calcium Channel Activation Stimulates Gene Expression by a Serum Response Factor-dependent Pathway" (PDF). The Journal of Biological Chemistry. 269 (41): 25483–25493. PMID 7929249. Retrieved 7 December 2019.
[edit | edit source]

Template:Sisterlinks


Licensed under CC BY-SA 3.0 | Source: https://www.wikidoc.org/index.php/Synaptic_Activity-Responsive_Elements
41 views | Status: cached on March 13 2026 12:52:34
↧ Download this article as ZWI file
Encyclosphere.org EncycloReader is supported by the EncyclosphereKSF