File:1N6J.pngDimeric structure of the MADS (red) and MEF2 (green) domains of the human MEF2B transcription factor complexed with DNA (orange) based on the PDB:1N6J crystallographic coordinates. Credit: Boghog2.File:MEF2 schematic.pngThe domain organization and sequence comparison of Mef2 proteins from representative species.[1] The amino acid numbering shown is of the human MEF2A sequence and the per cent sequence identities are all relative to hMEF2A. The three domain, MADS (red), MEF2 (green), and transactivation domains (TAD; cyan) are each highlighted in a different color. Credit: Boghog2.
"A unique synaptic activity-responsive element (SARE) sequence, composed of the consensus binding sites for SRF, MEF2 and CREB, is necessary for control of transcriptional upregulation of the Arc gene in response to synaptic activity."[2]
"The Ca2+/cAMP response element-binding protein (CREB) was initially identified as the main interlocutor in the dialogue between the synapse and the nucleus [1]."[2]
"MEF2 [is a transcription factor] necessary for long-term memory consolidation and storage."[2]
Myocyte enhancer factor-2 (MEF2) proteins are a family of transcription factors which through control of gene expression are important regulators of cellular differentiation and consequently play a critical role in embryonic development.[1] In adult organisms, Mef2 proteins mediate the stress response in some tissues.[1]
The "serum response factor SRF [is a transcription factor] necessary for long-term memory consolidation and storage."[2]
The serum response factor (SRF) is a transcription factor protein that binds to the c-fos serum response element (SRE).[3]
The serum response factor is a member of the MADS-box (MCM1, Agamous, Deficiens, and SRF) box superfamily of transcription factors,[4] binding to the serum response element (SRE) in the promoter region of target genes. This protein regulates the activity of many immediate early genes, for example c-fos, and thereby participates in cell cycle regulation, apoptosis, cell growth, and cell differentiation, is the downstream target of many pathways; for example, the mitogen-activated protein kinase pathway (MAPK) that acts through the ternary complex factors (TCFs).[5][6]
SRF is important during the development of the embryo, as it has been linked to the formation of mesoderm.[7][8] In the fully developed mammal, SRF is crucial for the growth of skeletal muscle.[9] Interaction of SRF with other proteins, such as steroid hormone receptors, may contribute to regulation of muscle growth by steroids.[10]
"Each species' promoter contains a cAMP/response element (CRE)1 consensus sequence ([11]) upstream of a TATA box. Two other members of this family of proteins, chromogranin B and secretogranin II (also known as chromogranin C), contain similar CRE and TATA homologies in their proximal gene promoters (8, 9)."[12]
"Within the cAMP-responsive element of the somatostatin gene, we observed an 8-base palindrome, 5'-TGACGTCA-3', which is highly conserved in many other genes whose expression is regulated by cAMP."[11]
"The current study delineates the conformational paradigm, clustered recognition, and comparative DNA binding preferences for MEF2A and MEF2B-specific MADS-box/MEF2 domains at the YTA(A/T)4TAR consensus motif."[13] Y = (C/T) and R = (A/G). The consensus sequence is (C/T)TA(A/T)(A/T)(A/T)(A/T)TA(A/G).[13]
Serum response factor is a member of the MADS (MCM1, Agamous, Deficiens, and SRF) box superfamily of transcription factors.[4] This protein binds to the serum response element (SRE) in the promoter region of target genes.
The SRE wild type (SREwt) contains the nucleotide sequence ACAGGATGTCCATATTAGGACATCTGC, of which CCATATTAGG is the CArG box, TTAGGACAT is the C/EBP box, and CATCTG is the E box.[14]
Copying each of the consensus sequences and putting the sequence in "⌘F" or from running the computer programs finds one MEF2 (CTAATTTTAA) between ZNF497 and A1BG or 5'-TGACGTCA-3' at 4317 between ZSCAN22 and A1BG, 5'-CCATATTAGG-3' is a CArG box that does not occur in either promoter of A1BG, TTAGGACAT is a C/EBP box that does not occur in either promoter, as can be found by the computer programs.
↑ 1.01.11.2Potthoff MJ, Olson EN (December 2007). "MEF2: a central regulator of diverse developmental programs". Development. 134 (23): 4131–40. doi:10.1242/dev.008367. PMID17959722.
↑Norman C, Runswick M, Pollock R, Treisman R (December 1988). "Isolation and properties of cDNA clones encoding SRF, a transcription factor that binds to the c-fos serum response element". Cell. 55 (6): 989–1003. doi:10.1016/0092-8674(88)90244-9. PMID3203386.